Incidental Mutation 'R3836:Olfr1045'
ID275619
Institutional Source Beutler Lab
Gene Symbol Olfr1045
Ensembl Gene ENSMUSG00000075198
Gene Nameolfactory receptor 1045
SynonymsMOR185-2, GA_x6K02T2Q125-47672825-47671878
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86195910-86203009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86198662 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000148982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099904] [ENSMUST00000215763]
Predicted Effect probably benign
Transcript: ENSMUST00000099904
AA Change: V30A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097488
Gene: ENSMUSG00000075198
AA Change: V30A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-43 PFAM
Pfam:7tm_1 41 290 5.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215763
AA Change: V30A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216885
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Olfr1045
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr1045 APN 2 86197805 makesense probably null
IGL01914:Olfr1045 APN 2 86198672 missense probably benign 0.45
IGL01991:Olfr1045 APN 2 86198533 missense probably benign 0.23
IGL02623:Olfr1045 APN 2 86198019 missense probably damaging 1.00
R0325:Olfr1045 UTSW 2 86198711 missense possibly damaging 0.51
R0730:Olfr1045 UTSW 2 86198725 missense probably benign 0.14
R1457:Olfr1045 UTSW 2 86198252 missense probably damaging 0.99
R2037:Olfr1045 UTSW 2 86197832 missense probably benign
R2121:Olfr1045 UTSW 2 86197996 missense possibly damaging 0.88
R2271:Olfr1045 UTSW 2 86197817 missense probably benign 0.00
R4669:Olfr1045 UTSW 2 86197933 missense possibly damaging 0.90
R6082:Olfr1045 UTSW 2 86198317 missense probably damaging 0.97
R7326:Olfr1045 UTSW 2 86198573 missense probably damaging 1.00
R7463:Olfr1045 UTSW 2 86197838 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTGCTACAATGAAAACCAGG -3'
(R):5'- GGACTGCACCTTGTATCAAATGG -3'

Sequencing Primer
(F):5'- AGGAATCCTCCCAGCTGAGTG -3'
(R):5'- GCACCTTGTATCAAATGGCAATGG -3'
Posted On2015-04-06