Incidental Mutation 'R3836:Sv2b'
ID275640
Institutional Source Beutler Lab
Gene Symbol Sv2b
Ensembl Gene ENSMUSG00000053025
Gene Namesynaptic vesicle glycoprotein 2 b
SynonymsA830038F04Rik
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location75114894-75309262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75157428 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 158 (M158K)
Ref Sequence ENSEMBL: ENSMUSP00000146049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085164] [ENSMUST00000165175] [ENSMUST00000206344]
Predicted Effect probably damaging
Transcript: ENSMUST00000085164
AA Change: M158K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082254
Gene: ENSMUSG00000053025
AA Change: M158K

DomainStartEndE-ValueType
Pfam:Sugar_tr 93 415 3.8e-29 PFAM
Pfam:MFS_1 111 429 9.3e-25 PFAM
Pfam:MFS_1 517 681 8.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165175
AA Change: M158K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127245
Gene: ENSMUSG00000053025
AA Change: M158K

DomainStartEndE-ValueType
Pfam:Sugar_tr 89 412 1.5e-29 PFAM
Pfam:MFS_1 111 429 9.5e-25 PFAM
Pfam:Pentapeptide_4 453 528 7.9e-11 PFAM
Pfam:MFS_1 516 681 5.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206344
AA Change: M158K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206845
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation are phenotypically normal, and Sv2a/Sv2b double knockouts are no more affected than Sv2a single knockouts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Sv2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01463:Sv2b APN 7 75136455 missense probably damaging 1.00
IGL02302:Sv2b APN 7 75124199 missense probably damaging 0.98
IGL02352:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02359:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02698:Sv2b APN 7 75140978 critical splice donor site probably null
IGL02713:Sv2b APN 7 75124163 missense possibly damaging 0.66
IGL03075:Sv2b APN 7 75136320 missense probably benign
IGL03392:Sv2b APN 7 75156760 critical splice acceptor site probably null
R0015:Sv2b UTSW 7 75125641 missense probably damaging 1.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0219:Sv2b UTSW 7 75157267 critical splice donor site probably null
R0277:Sv2b UTSW 7 75206439 missense possibly damaging 0.62
R0469:Sv2b UTSW 7 75136392 missense probably benign
R0510:Sv2b UTSW 7 75136392 missense probably benign
R1219:Sv2b UTSW 7 75136412 missense probably benign 0.01
R1307:Sv2b UTSW 7 75206434 missense probably damaging 1.00
R1476:Sv2b UTSW 7 75120043 missense possibly damaging 0.72
R1520:Sv2b UTSW 7 75157329 missense probably damaging 0.98
R1575:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1585:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1666:Sv2b UTSW 7 75206341 missense probably benign 0.01
R1712:Sv2b UTSW 7 75149059 missense possibly damaging 0.78
R1864:Sv2b UTSW 7 75124080 missense probably benign 0.17
R1993:Sv2b UTSW 7 75206341 missense probably benign 0.01
R2191:Sv2b UTSW 7 75124088 missense probably damaging 1.00
R4744:Sv2b UTSW 7 75206518 missense probably benign 0.01
R4757:Sv2b UTSW 7 75124170 missense probably benign 0.31
R4924:Sv2b UTSW 7 75136421 missense probably benign 0.20
R4990:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R4991:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R5038:Sv2b UTSW 7 75157425 missense probably damaging 1.00
R5726:Sv2b UTSW 7 75124214 missense possibly damaging 0.67
R5885:Sv2b UTSW 7 75156753 missense probably damaging 1.00
R6379:Sv2b UTSW 7 75136300 missense possibly damaging 0.73
R6410:Sv2b UTSW 7 75140109 missense probably benign 0.40
R6623:Sv2b UTSW 7 75206384 missense probably damaging 1.00
R6709:Sv2b UTSW 7 75124139 missense probably benign 0.40
R6873:Sv2b UTSW 7 75206206 missense probably damaging 1.00
R6889:Sv2b UTSW 7 75125767 intron probably null
R7123:Sv2b UTSW 7 75117702 missense possibly damaging 0.94
R7278:Sv2b UTSW 7 75147654 missense probably damaging 0.99
R7363:Sv2b UTSW 7 75147654 missense probably damaging 0.99
R7378:Sv2b UTSW 7 75147728 critical splice acceptor site probably null
R7426:Sv2b UTSW 7 75124064 missense probably damaging 1.00
R7452:Sv2b UTSW 7 75147713 missense probably damaging 1.00
R7504:Sv2b UTSW 7 75136383 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGAGCCAGTACATACCCTATGC -3'
(R):5'- GCAGAAAATCACCTTTGGATAGTCTC -3'

Sequencing Primer
(F):5'- GTACATACCCTATGCCTGAGATGAG -3'
(R):5'- ATAGTCTCTGATTTCCCATGGG -3'
Posted On2015-04-06