Incidental Mutation 'R3836:Crym'
ID275642
Institutional Source Beutler Lab
Gene Symbol Crym
Ensembl Gene ENSMUSG00000030905
Gene Namecrystallin, mu
Synonyms
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3836 (G1)
Quality Score220
Status Validated
Chromosome7
Chromosomal Location120186380-120202111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120201216 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 61 (V61A)
Ref Sequence ENSEMBL: ENSMUSP00000033198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033198] [ENSMUST00000084640]
PDB Structure
Crystal structure of the apo form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Crystal structure of the NADPH form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Cristal structure of the NADPH-T3 form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033198
AA Change: V61A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033198
Gene: ENSMUSG00000030905
AA Change: V61A

DomainStartEndE-ValueType
Pfam:OCD_Mu_crystall 3 313 7.1e-113 PFAM
Pfam:Shikimate_DH 124 227 7.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084640
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]
PHENOTYPE: At the euthyroid state, homozygotes display a normal growth curve, heart rate and hearing ability but have significantly reduced serum concentrations of triiodothyronine (T3) and thyroxine (T4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Crym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Crym APN 7 120195399 missense probably damaging 0.98
IGL03355:Crym APN 7 120199313 splice site probably null
R0393:Crym UTSW 7 120189749 missense probably benign 0.00
R1538:Crym UTSW 7 120197715 missense probably benign 0.05
R2508:Crym UTSW 7 120201827 missense probably benign 0.08
R4328:Crym UTSW 7 120195339 missense probably damaging 1.00
R4723:Crym UTSW 7 120201075 critical splice donor site probably null
R5046:Crym UTSW 7 120195444 missense possibly damaging 0.71
R5122:Crym UTSW 7 120195495 missense probably benign 0.00
R5266:Crym UTSW 7 120199294 missense probably benign 0.00
R5427:Crym UTSW 7 120199222 unclassified probably benign
R5567:Crym UTSW 7 120201893 missense probably benign 0.00
R5570:Crym UTSW 7 120201893 missense probably benign 0.00
R5704:Crym UTSW 7 120201940 unclassified probably null
R6835:Crym UTSW 7 120186645 missense probably benign
R7274:Crym UTSW 7 120190519 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTCTCTATTCCAGGGGAGG -3'
(R):5'- TTTCTGGTCCAGAGCCAGAC -3'

Sequencing Primer
(F):5'- TCTATTCCAGGGGAGGCTTCC -3'
(R):5'- TGAGTCCAGCCTCAGGGAAG -3'
Posted On2015-04-06