Incidental Mutation 'R3836:AW551984'
ID275646
Institutional Source Beutler Lab
Gene Symbol AW551984
Ensembl Gene ENSMUSG00000038112
Gene Nameexpressed sequence AW551984
Synonyms
MMRRC Submission 040891-MU
Accession Numbers

Genbank: NM_178737; MGI: 2143322

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39587396-39604403 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 39597908 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042485] [ENSMUST00000119722] [ENSMUST00000130829] [ENSMUST00000141370]
Predicted Effect probably benign
Transcript: ENSMUST00000042485
SMART Domains Protein: ENSMUSP00000042582
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119722
SMART Domains Protein: ENSMUSP00000113212
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130829
SMART Domains Protein: ENSMUSP00000117262
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
Pfam:VIT_2 5 52 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136814
Predicted Effect probably benign
Transcript: ENSMUST00000141370
SMART Domains Protein: ENSMUSP00000117328
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in AW551984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:AW551984 APN 9 39592849 missense probably benign 0.16
IGL00869:AW551984 APN 9 39593434 splice site probably benign
IGL01411:AW551984 APN 9 39593791 missense possibly damaging 0.69
IGL01744:AW551984 APN 9 39591272 missense probably benign 0.01
IGL02102:AW551984 APN 9 39589691 missense probably damaging 1.00
IGL02149:AW551984 APN 9 39592924 missense probably benign 0.06
IGL02151:AW551984 APN 9 39592945 missense probably benign 0.35
IGL02154:AW551984 APN 9 39589102 missense possibly damaging 0.93
IGL02158:AW551984 APN 9 39599325 missense probably null 0.99
IGL02574:AW551984 APN 9 39589086 missense possibly damaging 0.91
IGL02754:AW551984 APN 9 39596626 nonsense probably null
IGL02754:AW551984 APN 9 39593328 critical splice donor site probably null
IGL02838:AW551984 APN 9 39594643 missense probably damaging 1.00
IGL03240:AW551984 APN 9 39589122 missense probably benign 0.00
IGL03328:AW551984 APN 9 39597116 missense probably damaging 1.00
IGL03374:AW551984 APN 9 39599766 missense possibly damaging 0.52
PIT4260001:AW551984 UTSW 9 39592979 missense probably benign 0.08
R0141:AW551984 UTSW 9 39590644 missense probably damaging 1.00
R0269:AW551984 UTSW 9 39599950 missense probably damaging 1.00
R0365:AW551984 UTSW 9 39599321 missense probably benign 0.14
R0453:AW551984 UTSW 9 39600641 missense probably damaging 1.00
R0481:AW551984 UTSW 9 39600616 missense probably null 1.00
R1005:AW551984 UTSW 9 39593733 nonsense probably null
R1585:AW551984 UTSW 9 39599336 nonsense probably null
R2177:AW551984 UTSW 9 39599815 missense probably benign
R3117:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3119:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3837:AW551984 UTSW 9 39597908 unclassified probably benign
R3839:AW551984 UTSW 9 39597908 unclassified probably benign
R4299:AW551984 UTSW 9 39592979 missense probably benign 0.08
R4422:AW551984 UTSW 9 39600077 missense probably null 0.00
R4713:AW551984 UTSW 9 39597153 missense probably benign 0.13
R4905:AW551984 UTSW 9 39597158 missense probably damaging 0.99
R4966:AW551984 UTSW 9 39597176 missense possibly damaging 0.92
R5022:AW551984 UTSW 9 39597965 missense probably benign 0.00
R5041:AW551984 UTSW 9 39600598 missense probably damaging 1.00
R5342:AW551984 UTSW 9 39594551 missense probably damaging 1.00
R5383:AW551984 UTSW 9 39590698 missense probably benign
R5443:AW551984 UTSW 9 39598029 missense possibly damaging 0.94
R5532:AW551984 UTSW 9 39597185 missense probably damaging 1.00
R5536:AW551984 UTSW 9 39592873 missense probably benign 0.04
R5586:AW551984 UTSW 9 39591263 missense probably benign 0.01
R5601:AW551984 UTSW 9 39591267 missense possibly damaging 0.87
R5618:AW551984 UTSW 9 39590704 missense probably damaging 1.00
R5701:AW551984 UTSW 9 39592822 missense probably benign 0.01
R6122:AW551984 UTSW 9 39593755 missense probably benign 0.00
R6142:AW551984 UTSW 9 39597114 missense probably benign 0.00
R6272:AW551984 UTSW 9 39598037 missense probably benign 0.06
R6429:AW551984 UTSW 9 39600614 missense probably damaging 1.00
R6659:AW551984 UTSW 9 39589099 missense probably benign 0.00
R6670:AW551984 UTSW 9 39592996 missense probably damaging 1.00
R6791:AW551984 UTSW 9 39600659 missense probably damaging 1.00
R7000:AW551984 UTSW 9 39600789 missense probably benign 0.11
R7077:AW551984 UTSW 9 39591427 missense probably benign
R7083:AW551984 UTSW 9 39597647 missense probably damaging 1.00
R7352:AW551984 UTSW 9 39592925 missense probably benign
R7475:AW551984 UTSW 9 39597940 missense probably damaging 1.00
Z1088:AW551984 UTSW 9 39590603 nonsense probably null
ZE80:AW551984 UTSW 9 39593667 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGAATCAGTGTTTCCTGG -3'
(R):5'- AGTTTAATGGGAGCACCTTCTG -3'

Sequencing Primer
(F):5'- CCAGCAAAGTGATTGGGTGTGC -3'
(R):5'- CTGCAATGGTGAGTTTCTACCCAG -3'
Posted On2015-04-06