Incidental Mutation 'R3836:Olfr191'
ID275666
Institutional Source Beutler Lab
Gene Symbol Olfr191
Ensembl Gene ENSMUSG00000094539
Gene Nameolfactory receptor 191
SynonymsGA_x54KRFPKG5P-55314632-55313703, MOR183-5P
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59082829-59089822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59086223 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000150473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078517] [ENSMUST00000205471] [ENSMUST00000215647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078517
AA Change: S87P

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077604
Gene: ENSMUSG00000094539
AA Change: S87P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-47 PFAM
Pfam:7tm_1 41 290 6.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205471
AA Change: S87P
Predicted Effect possibly damaging
Transcript: ENSMUST00000215647
AA Change: S87P

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Olfr191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr191 APN 16 59086393 missense possibly damaging 0.86
IGL01553:Olfr191 APN 16 59086322 missense probably benign 0.35
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R1367:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R1631:Olfr191 UTSW 16 59086045 missense probably benign
R1660:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R2166:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2167:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2168:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2191:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R4999:Olfr191 UTSW 16 59086402 missense probably damaging 1.00
R5386:Olfr191 UTSW 16 59085890 missense probably benign
R5589:Olfr191 UTSW 16 59085971 missense probably benign 0.03
R5590:Olfr191 UTSW 16 59085997 missense probably benign 0.06
R5609:Olfr191 UTSW 16 59086076 missense possibly damaging 0.96
R5965:Olfr191 UTSW 16 59086303 missense probably damaging 1.00
R5989:Olfr191 UTSW 16 59086334 missense probably benign 0.00
R6049:Olfr191 UTSW 16 59086146 nonsense probably null
R6058:Olfr191 UTSW 16 59085910 missense probably damaging 0.99
R6058:Olfr191 UTSW 16 59086429 missense probably benign
R6250:Olfr191 UTSW 16 59085832 missense probably damaging 1.00
R6319:Olfr191 UTSW 16 59086021 missense probably benign 0.08
R6473:Olfr191 UTSW 16 59086043 missense probably benign 0.09
R6524:Olfr191 UTSW 16 59086277 missense possibly damaging 0.76
R6748:Olfr191 UTSW 16 59085890 missense probably benign
R6874:Olfr191 UTSW 16 59085949 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCTTCGTGAATTAAAGCATGAATG -3'
(R):5'- ATCTGCCCCAGTGGAAAATCC -3'

Sequencing Primer
(F):5'- GCATGAATGAATCCACCTAAAAAGG -3'
(R):5'- AGTGGAAAATCCCCCTGTTC -3'
Posted On2015-04-06