Incidental Mutation 'R3836:Map3k11'
ID275670
Institutional Source Beutler Lab
Gene Symbol Map3k11
Ensembl Gene ENSMUSG00000004054
Gene Namemitogen-activated protein kinase kinase kinase 11
SynonymsMlk3, 2610017K16Rik
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5689131-5702862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5690803 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 186 (E186G)
Ref Sequence ENSEMBL: ENSMUSP00000004156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156] [ENSMUST00000068169] [ENSMUST00000113615]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004156
AA Change: E186G

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054
AA Change: E186G

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068169
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113615
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135119
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted or spontaneous mutation display a pattern of dark red stripes of thin dorsal epithelium during pre-wean development, and necrotic dental pulp has been reported for the spontaneous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Map3k11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Map3k11 APN 19 5697623 missense possibly damaging 0.91
IGL02581:Map3k11 APN 19 5700806 missense probably benign
R0130:Map3k11 UTSW 19 5690815 missense probably damaging 1.00
R0193:Map3k11 UTSW 19 5695846 missense probably damaging 0.99
R1621:Map3k11 UTSW 19 5690806 missense probably damaging 1.00
R1736:Map3k11 UTSW 19 5697401 missense probably benign 0.34
R1791:Map3k11 UTSW 19 5695572 nonsense probably null
R3500:Map3k11 UTSW 19 5690247 start codon destroyed probably benign 0.08
R3892:Map3k11 UTSW 19 5702283 missense probably benign 0.13
R4303:Map3k11 UTSW 19 5690824 missense probably damaging 1.00
R4513:Map3k11 UTSW 19 5702210 missense probably damaging 0.97
R4613:Map3k11 UTSW 19 5697470 missense probably benign 0.18
R4613:Map3k11 UTSW 19 5697471 missense probably damaging 0.98
R4631:Map3k11 UTSW 19 5690913 missense probably benign 0.30
R4780:Map3k11 UTSW 19 5690938 missense probably damaging 0.99
R5213:Map3k11 UTSW 19 5690641 missense probably damaging 0.99
R5266:Map3k11 UTSW 19 5700594 missense probably benign 0.03
R5372:Map3k11 UTSW 19 5690962 missense probably damaging 1.00
R5736:Map3k11 UTSW 19 5696711 missense probably damaging 1.00
R5899:Map3k11 UTSW 19 5695909 critical splice donor site probably null
R6052:Map3k11 UTSW 19 5697402 missense probably benign 0.01
R6388:Map3k11 UTSW 19 5690251 missense probably damaging 0.96
R6623:Map3k11 UTSW 19 5695603 missense probably damaging 0.97
R6975:Map3k11 UTSW 19 5690727 missense possibly damaging 0.91
R7309:Map3k11 UTSW 19 5690458 missense probably damaging 0.99
X0025:Map3k11 UTSW 19 5696195 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACTATGTATCTCGGGGTGGAG -3'
(R):5'- TCTCGGTGTATCACAGGCAC -3'

Sequencing Primer
(F):5'- ATCGGTGGCTTCGGCAAG -3'
(R):5'- GTGTATCACAGGCACCAGAGC -3'
Posted On2015-04-06