Incidental Mutation 'R3837:Dnajb2'
ID275677
Institutional Source Beutler Lab
Gene Symbol Dnajb2
Ensembl Gene ENSMUSG00000026203
Gene NameDnaJ heat shock protein family (Hsp40) member B2
SynonymsmDj8, 2700059H22Rik, Dnajb10
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75236406-75245692 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 75241480 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055223] [ENSMUST00000082158] [ENSMUST00000185403] [ENSMUST00000185654] [ENSMUST00000187058] [ENSMUST00000188290] [ENSMUST00000188346] [ENSMUST00000188931]
Predicted Effect probably null
Transcript: ENSMUST00000055223
SMART Domains Protein: ENSMUSP00000052520
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000082158
SMART Domains Protein: ENSMUSP00000080796
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185403
SMART Domains Protein: ENSMUSP00000139982
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185654
SMART Domains Protein: ENSMUSP00000140456
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.3e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186600
Predicted Effect probably null
Transcript: ENSMUST00000187058
SMART Domains Protein: ENSMUSP00000140637
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188290
SMART Domains Protein: ENSMUSP00000140634
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188346
SMART Domains Protein: ENSMUSP00000140588
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188628
Predicted Effect probably null
Transcript: ENSMUST00000188931
SMART Domains Protein: ENSMUSP00000140566
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190379
Predicted Effect probably benign
Transcript: ENSMUST00000190445
Meta Mutation Damage Score 0.694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Dnajb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb2 APN 1 75236890 missense probably damaging 1.00
R0494:Dnajb2 UTSW 1 75239634 unclassified probably benign
R2118:Dnajb2 UTSW 1 75237477 missense probably damaging 1.00
R3838:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3839:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R4105:Dnajb2 UTSW 1 75236899 nonsense probably null
R4108:Dnajb2 UTSW 1 75236899 nonsense probably null
R4858:Dnajb2 UTSW 1 75243554 missense possibly damaging 0.96
R7115:Dnajb2 UTSW 1 75243662 missense
Predicted Primers PCR Primer
(F):5'- GTCCACCACCTTTGTCCAAG -3'
(R):5'- TTCCACAGGTACATTAATGGGC -3'

Sequencing Primer
(F):5'- GCAGGTGAGCTCTCCTTCTG -3'
(R):5'- CCACAGGTACATTAATGGGCTCATG -3'
Posted On2015-04-06