Incidental Mutation 'R3837:Polr1b'
ID275684
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
MMRRC Submission 040778-MU
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3837 (G1)
Quality Score198
Status Validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129119107 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 662 (F662Y)
Ref Sequence ENSEMBL: ENSMUSP00000028874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000103205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028874
AA Change: F662Y

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395
AA Change: F662Y

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103205
AA Change: F662Y

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: F662Y

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147727
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGTGATGTAAGCACTGTGC -3'
(R):5'- AACTGGGCAAGCTGGTAAC -3'

Sequencing Primer
(F):5'- ACTGTGCAGCCTCGAGG -3'
(R):5'- TGGTAACAGAACAGACGTCTCATCTG -3'
Posted On2015-04-06