Incidental Mutation 'R3837:Fam13c'
ID275705
Institutional Source Beutler Lab
Gene Symbol Fam13c
Ensembl Gene ENSMUSG00000043259
Gene Namefamily with sequence similarity 13, member C
Synonyms
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location70440481-70558736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70542648 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 336 (S336L)
Ref Sequence ENSEMBL: ENSMUSP00000134648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062883] [ENSMUST00000105436] [ENSMUST00000173042]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062883
AA Change: S336L

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051375
Gene: ENSMUSG00000043259
AA Change: S336L

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 529 557 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105436
AA Change: S254L

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101076
Gene: ENSMUSG00000043259
AA Change: S254L

DomainStartEndE-ValueType
low complexity region 118 140 N/A INTRINSIC
low complexity region 192 212 N/A INTRINSIC
coiled coil region 222 290 N/A INTRINSIC
coiled coil region 447 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173042
AA Change: S336L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134648
Gene: ENSMUSG00000043259
AA Change: S336L

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 528 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220442
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Fam13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Fam13c APN 10 70448816 critical splice donor site probably null
IGL02060:Fam13c APN 10 70553141 missense probably damaging 1.00
IGL03218:Fam13c APN 10 70448769 missense possibly damaging 0.46
R0270:Fam13c UTSW 10 70544513 missense probably benign 0.05
R0418:Fam13c UTSW 10 70534761 missense probably damaging 1.00
R0617:Fam13c UTSW 10 70536352 splice site probably benign
R1712:Fam13c UTSW 10 70554573 missense possibly damaging 0.80
R1967:Fam13c UTSW 10 70551735 missense probably damaging 1.00
R2165:Fam13c UTSW 10 70542693 missense probably damaging 1.00
R3836:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3838:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3839:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R4059:Fam13c UTSW 10 70554508 missense probably damaging 1.00
R4768:Fam13c UTSW 10 70551750 missense probably damaging 0.96
R4951:Fam13c UTSW 10 70551791 critical splice donor site probably null
R5259:Fam13c UTSW 10 70441063 missense probably benign 0.16
R5384:Fam13c UTSW 10 70553069 missense probably benign 0.03
R5715:Fam13c UTSW 10 70534840 missense probably damaging 1.00
R6322:Fam13c UTSW 10 70498891 missense probably damaging 0.99
R6404:Fam13c UTSW 10 70448816 critical splice donor site probably null
R6723:Fam13c UTSW 10 70554525 missense probably damaging 1.00
R7111:Fam13c UTSW 10 70554506 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGTGTTCAGCTCGACGTGTC -3'
(R):5'- GCCTCAGTTCAAGAAGGAAAC -3'

Sequencing Primer
(F):5'- AGCTCGACGTGTCTCTGAATTC -3'
(R):5'- GCCTCAGTTCAAGAAGGAAACCAAAG -3'
Posted On2015-04-06