Incidental Mutation 'R3837:Nap1l1'
ID275706
Institutional Source Beutler Lab
Gene Symbol Nap1l1
Ensembl Gene ENSMUSG00000058799
Gene Namenucleosome assembly protein 1-like 1
SynonymsD10Ertd68e
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111473223-111498150 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 111495322 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]
Predicted Effect probably null
Transcript: ENSMUST00000065917
SMART Domains Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799

DomainStartEndE-ValueType
coiled coil region 6 31 N/A INTRINSIC
Pfam:NAP 75 346 1.5e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171797
SMART Domains Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 33 58 N/A INTRINSIC
Pfam:NAP 103 372 9.6e-110 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217908
Predicted Effect probably null
Transcript: ENSMUST00000218828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218982
Predicted Effect probably benign
Transcript: ENSMUST00000219143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219718
Predicted Effect probably benign
Transcript: ENSMUST00000219961
Meta Mutation Damage Score 0.6556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Nap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Nap1l1 APN 10 111486675 missense probably damaging 0.98
IGL01453:Nap1l1 APN 10 111492978 missense probably benign 0.09
IGL01734:Nap1l1 APN 10 111492899 missense probably benign 0.26
IGL01843:Nap1l1 APN 10 111492911 missense possibly damaging 0.93
PIT1430001:Nap1l1 UTSW 10 111486736 missense probably damaging 1.00
PIT4131001:Nap1l1 UTSW 10 111486722 missense probably null
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0132:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0601:Nap1l1 UTSW 10 111490363 splice site probably benign
R1576:Nap1l1 UTSW 10 111494820 missense probably damaging 1.00
R1619:Nap1l1 UTSW 10 111493379 missense possibly damaging 0.77
R1969:Nap1l1 UTSW 10 111491053 missense probably benign 0.03
R2071:Nap1l1 UTSW 10 111492900 missense possibly damaging 0.46
R2383:Nap1l1 UTSW 10 111493411 missense probably damaging 1.00
R3836:Nap1l1 UTSW 10 111495322 splice site probably null
R3838:Nap1l1 UTSW 10 111495322 splice site probably null
R3839:Nap1l1 UTSW 10 111495322 splice site probably null
R4084:Nap1l1 UTSW 10 111490077 missense possibly damaging 0.92
R4609:Nap1l1 UTSW 10 111492880 nonsense probably null
R4985:Nap1l1 UTSW 10 111490083 missense probably benign 0.01
R5906:Nap1l1 UTSW 10 111491030 nonsense probably null
R5982:Nap1l1 UTSW 10 111495368 missense possibly damaging 0.71
R6522:Nap1l1 UTSW 10 111494223 missense probably damaging 0.99
R6868:Nap1l1 UTSW 10 111494808 missense probably damaging 1.00
R7134:Nap1l1 UTSW 10 111494794 critical splice acceptor site probably null
R7202:Nap1l1 UTSW 10 111491103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGGCTGCAGTAAATCTTTTC -3'
(R):5'- CCTTTGTGTGGAAAACAATCTAAGC -3'

Sequencing Primer
(F):5'- AAAGCTGTCTGGATGTCTCAAG -3'
(R):5'- TGTGTGGAAAACAATCTAAGCAACAG -3'
Posted On2015-04-06