Incidental Mutation 'R3837:Msh3'
ID275713
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92354858 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 15 (G15C)
Ref Sequence ENSEMBL: ENSMUSP00000140659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022218] [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187424] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022218
SMART Domains Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707

DomainStartEndE-ValueType
Pfam:DHFR_1 4 185 3.9e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000022220
AA Change: G15C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: G15C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185852
AA Change: G15C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: G15C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186878
Predicted Effect unknown
Transcript: ENSMUST00000187424
AA Change: G15C
SMART Domains Protein: ENSMUSP00000139622
Gene: ENSMUSG00000014850
AA Change: G15C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187831
Predicted Effect unknown
Transcript: ENSMUST00000187874
AA Change: G15C
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850
AA Change: G15C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190393
AA Change: G15C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850
AA Change: G15C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191509
AA Change: G15C
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850
AA Change: G15C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191550
AA Change: G15C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850
AA Change: G15C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.87
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGCTCTCCATAAGGCCTCCG -3'
(R):5'- CGCATTCTATTTGTGTAGCTAAGG -3'

Sequencing Primer
(F):5'- ATAAGGCCTCCGCTTCCG -3'
(R):5'- TCCTAGCAGGCCGGCTCTT -3'
Posted On2015-04-06