Incidental Mutation 'R3837:Fam35a'
ID275718
Institutional Source Beutler Lab
Gene Symbol Fam35a
Ensembl Gene ENSMUSG00000041471
Gene Namefamily with sequence similarity 35, member A
Synonyms3110001K24Rik
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34237033-34310493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34249185 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 581 (V581A)
Ref Sequence ENSEMBL: ENSMUSP00000107548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111917] [ENSMUST00000228704]
Predicted Effect probably damaging
Transcript: ENSMUST00000111917
AA Change: V581A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107548
Gene: ENSMUSG00000041471
AA Change: V581A

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
Pfam:FAM35_C 694 866 4.6e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228704
AA Change: V29A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Fam35a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Fam35a APN 14 34268625 missense probably benign 0.02
IGL00962:Fam35a APN 14 34249251 missense probably damaging 1.00
IGL01288:Fam35a APN 14 34259643 missense probably benign 0.00
IGL01302:Fam35a APN 14 34259727 missense probably benign 0.03
IGL01312:Fam35a APN 14 34268193 missense possibly damaging 0.56
IGL01444:Fam35a APN 14 34237557 missense probably damaging 1.00
IGL01633:Fam35a APN 14 34249179 missense probably damaging 1.00
IGL02251:Fam35a APN 14 34268278 missense probably benign 0.10
IGL02927:Fam35a APN 14 34267701 missense probably damaging 1.00
IGL03183:Fam35a APN 14 34245186 missense probably benign 0.02
IGL03226:Fam35a APN 14 34268371 missense probably benign 0.08
R0111:Fam35a UTSW 14 34267729 missense probably damaging 0.98
R1170:Fam35a UTSW 14 34268491 missense possibly damaging 0.92
R1348:Fam35a UTSW 14 34268923 missense probably damaging 1.00
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1538:Fam35a UTSW 14 34268876 missense probably damaging 1.00
R1602:Fam35a UTSW 14 34267650 missense probably damaging 1.00
R1650:Fam35a UTSW 14 34259617 intron probably benign
R1777:Fam35a UTSW 14 34268173 missense probably benign 0.07
R1843:Fam35a UTSW 14 34267803 missense probably benign 0.01
R2425:Fam35a UTSW 14 34268689 missense probably damaging 0.96
R3838:Fam35a UTSW 14 34245368 missense probably benign 0.01
R3904:Fam35a UTSW 14 34259709 missense probably damaging 1.00
R3964:Fam35a UTSW 14 34259687 missense probably damaging 1.00
R4322:Fam35a UTSW 14 34259675 missense probably damaging 0.99
R4708:Fam35a UTSW 14 34267833 missense probably benign 0.17
R4771:Fam35a UTSW 14 34268706 missense probably damaging 1.00
R4838:Fam35a UTSW 14 34268625 missense probably benign 0.02
R5448:Fam35a UTSW 14 34268370 missense probably benign 0.32
R5874:Fam35a UTSW 14 34245258 missense probably benign 0.08
R6332:Fam35a UTSW 14 34268172 missense probably benign 0.07
R6333:Fam35a UTSW 14 34267608 missense probably damaging 1.00
R6476:Fam35a UTSW 14 34268014 missense probably benign 0.27
R6576:Fam35a UTSW 14 34268242 missense probably damaging 1.00
R7172:Fam35a UTSW 14 34237568 missense probably damaging 1.00
X0009:Fam35a UTSW 14 34245186 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCCTGTTCCACGGTTAAC -3'
(R):5'- GCTTCCTTAGATTCCAATGTAATTGCC -3'

Sequencing Primer
(F):5'- GCCTGTTCCACGGTTAACACAAC -3'
(R):5'- ATTGCCAATGTTATACTTCAGGAC -3'
Posted On2015-04-06