Incidental Mutation 'R3837:4930474N05Rik'
ID275719
Institutional Source Beutler Lab
Gene Symbol 4930474N05Rik
Ensembl Gene ENSMUSG00000096405
Gene NameRIKEN cDNA 4930474N05 gene
Synonyms
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location36094917-36100114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36095478 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 112 (G112S)
Ref Sequence ENSEMBL: ENSMUSP00000153709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177985] [ENSMUST00000186722] [ENSMUST00000226305]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100708
SMART Domains Protein: ENSMUSP00000098274
Gene: ENSMUSG00000072616

DomainStartEndE-ValueType
RasGEFN 7 128 4.76e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177985
SMART Domains Protein: ENSMUSP00000136756
Gene: ENSMUSG00000096405

DomainStartEndE-ValueType
RasGEFN 65 184 3.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186722
Predicted Effect probably benign
Transcript: ENSMUST00000226305
AA Change: G112S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in 4930474N05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:4930474N05Rik APN 14 36096422 missense possibly damaging 0.54
IGL01694:4930474N05Rik APN 14 36096702 makesense probably null
IGL02821:4930474N05Rik APN 14 36096516 missense probably benign 0.19
R0071:4930474N05Rik UTSW 14 36090789 unclassified probably benign
R0537:4930474N05Rik UTSW 14 36096700 missense probably benign 0.07
R0960:4930474N05Rik UTSW 14 36096410 missense probably benign 0.01
R1919:4930474N05Rik UTSW 14 36095457 missense possibly damaging 0.48
R2338:4930474N05Rik UTSW 14 36095152 missense probably benign
R4192:4930474N05Rik UTSW 14 36096579 missense possibly damaging 0.94
R4193:4930474N05Rik UTSW 14 36096579 missense possibly damaging 0.94
R4526:4930474N05Rik UTSW 14 36096578 missense probably damaging 1.00
R7007:4930474N05Rik UTSW 14 36095164 missense probably benign 0.18
R7302:4930474N05Rik UTSW 14 36095349 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAATGAGAATGCTGCAGAC -3'
(R):5'- CTACAGGGTCAGCGACAATC -3'

Sequencing Primer
(F):5'- TGAGAATGCTGCAGACCTATGTC -3'
(R):5'- TCAGCGACAATCAGAGAGAGAC -3'
Posted On2015-04-06