Incidental Mutation 'R3837:Gpam'
ID275725
Institutional Source Beutler Lab
Gene Symbol Gpam
Ensembl Gene ENSMUSG00000024978
Gene Nameglycerol-3-phosphate acyltransferase, mitochondrial
SynonymsGPAT1
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55069734-55099451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55080458 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 450 (N450S)
Ref Sequence ENSEMBL: ENSMUSP00000057635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061856]
Predicted Effect probably benign
Transcript: ENSMUST00000061856
AA Change: N450S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057635
Gene: ENSMUSG00000024978
AA Change: N450S

DomainStartEndE-ValueType
Blast:PlsC 5 34 3e-8 BLAST
PlsC 224 357 2.46e-23 SMART
Blast:PlsC 499 551 8e-27 BLAST
low complexity region 687 699 N/A INTRINSIC
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutant mice weighed less than controls and showed reduced triacylglycerol levels in the liver and plasma. The glycerolipid fatty acid composition is also disrupted in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Gpam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpam APN 19 55078332 missense possibly damaging 0.71
IGL01349:Gpam APN 19 55096119 critical splice donor site probably null
IGL01515:Gpam APN 19 55087451 missense probably damaging 1.00
IGL01650:Gpam APN 19 55081700 missense probably benign 0.02
IGL01768:Gpam APN 19 55087520 missense probably benign 0.00
IGL01809:Gpam APN 19 55075625 nonsense probably null
IGL01878:Gpam APN 19 55083374 missense probably benign 0.22
IGL02451:Gpam APN 19 55088203 missense probably damaging 1.00
IGL03293:Gpam APN 19 55071016 missense probably benign
IGL03391:Gpam APN 19 55081696 missense probably damaging 1.00
R0492:Gpam UTSW 19 55096179 missense possibly damaging 0.72
R0703:Gpam UTSW 19 55072756 missense probably benign 0.00
R1083:Gpam UTSW 19 55088211 splice site probably benign
R1432:Gpam UTSW 19 55079261 missense probably damaging 0.99
R1457:Gpam UTSW 19 55088176 missense probably damaging 1.00
R1556:Gpam UTSW 19 55076331 missense possibly damaging 0.94
R1733:Gpam UTSW 19 55081469 missense probably damaging 0.99
R1744:Gpam UTSW 19 55074591 missense probably damaging 1.00
R1776:Gpam UTSW 19 55078575 missense possibly damaging 0.88
R2267:Gpam UTSW 19 55072710 critical splice donor site probably null
R2697:Gpam UTSW 19 55083209 missense probably damaging 1.00
R3836:Gpam UTSW 19 55080458 missense probably benign
R3838:Gpam UTSW 19 55080458 missense probably benign
R3839:Gpam UTSW 19 55080458 missense probably benign
R4670:Gpam UTSW 19 55096119 critical splice donor site probably null
R4717:Gpam UTSW 19 55075614 missense probably benign 0.00
R4819:Gpam UTSW 19 55078341 missense probably benign 0.03
R5104:Gpam UTSW 19 55093986 missense probably benign 0.44
R5146:Gpam UTSW 19 55093946 missense probably damaging 1.00
R5183:Gpam UTSW 19 55083227 missense probably damaging 1.00
R5326:Gpam UTSW 19 55091165 missense probably benign 0.05
R5347:Gpam UTSW 19 55088837 missense probably damaging 1.00
R5621:Gpam UTSW 19 55079260 missense probably damaging 1.00
R5644:Gpam UTSW 19 55088899 missense probably benign 0.00
R6244:Gpam UTSW 19 55070985 missense probably damaging 1.00
R6260:Gpam UTSW 19 55083406 missense probably benign 0.40
R6965:Gpam UTSW 19 55074609 missense probably damaging 1.00
R7125:Gpam UTSW 19 55076335 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGACTCAGAAGAGGGATCCCC -3'
(R):5'- TGTACCTTCTAAAGCATGAGGC -3'

Sequencing Primer
(F):5'- CCCATCGGAGTTCCAAATGTG -3'
(R):5'- CTTGTGTATGTCAGCCCAGCAG -3'
Posted On2015-04-06