Incidental Mutation 'R3837:Glra2'
ID275727
Institutional Source Beutler Lab
Gene Symbol Glra2
Ensembl Gene ENSMUSG00000018589
Gene Nameglycine receptor, alpha 2 subunit
Synonyms
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R3837 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location165129017-165327393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 165289616 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 85 (V85I)
Ref Sequence ENSEMBL: ENSMUSP00000060827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058787]
Predicted Effect probably benign
Transcript: ENSMUST00000058787
AA Change: V85I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060827
Gene: ENSMUSG00000018589
AA Change: V85I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 44 254 1.6e-55 PFAM
Pfam:Neur_chan_memb 261 373 3.4e-35 PFAM
transmembrane domain 424 441 N/A INTRINSIC
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine receptor consists of two subunits, alpha and beta, and acts as a pentamer. The protein encoded by this gene is an alpha subunit and can bind strychnine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele lack cortical neuron responses to glycine and taurine but are otherwise normal. Mice homozygous for another targeted allele exhibit impaired interneuron migration into the cortical wall. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Glra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Glra2 APN X 165289637 missense possibly damaging 0.81
IGL01341:Glra2 APN X 165324566 missense probably damaging 0.97
IGL02590:Glra2 APN X 165254226 missense probably benign 0.05
R3839:Glra2 UTSW X 165289616 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGATGGCTTCAATGCTCAGTC -3'
(R):5'- GGGAAGTTATCATGCAGTTCTG -3'

Sequencing Primer
(F):5'- CAGTCCCACTCACCATTGTAG -3'
(R):5'- CGCTAACCACAGATGTTG -3'
Posted On2015-04-06