Incidental Mutation 'R3848:Tmem245'
ID275751
Institutional Source Beutler Lab
Gene Symbol Tmem245
Ensembl Gene ENSMUSG00000055296
Gene Nametransmembrane protein 245
Synonyms
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56866923-56947437 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 56926298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068792] [ENSMUST00000107609] [ENSMUST00000132816]
Predicted Effect probably benign
Transcript: ENSMUST00000068792
SMART Domains Protein: ENSMUSP00000067421
Gene: ENSMUSG00000055296

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
Pfam:UPF0118 589 838 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107609
SMART Domains Protein: ENSMUSP00000103234
Gene: ENSMUSG00000055296

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
Pfam:UPF0118 585 842 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125082
Predicted Effect probably benign
Transcript: ENSMUST00000132816
SMART Domains Protein: ENSMUSP00000117449
Gene: ENSMUSG00000055296

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:UPF0118 182 433 4.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155625
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Tmem245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02472:Tmem245 APN 4 56899119 missense probably damaging 1.00
IGL02668:Tmem245 APN 4 56925081 missense possibly damaging 0.86
IGL03093:Tmem245 APN 4 56886019 missense probably damaging 1.00
R0090:Tmem245 UTSW 4 56899410 missense probably benign
R0116:Tmem245 UTSW 4 56926213 missense probably benign 0.00
R0648:Tmem245 UTSW 4 56906270 missense probably benign 0.38
R0864:Tmem245 UTSW 4 56890837 missense probably damaging 1.00
R1102:Tmem245 UTSW 4 56903200 intron probably benign
R1548:Tmem245 UTSW 4 56906233 nonsense probably null
R1778:Tmem245 UTSW 4 56903968 missense probably damaging 1.00
R1840:Tmem245 UTSW 4 56903947 missense probably benign 0.03
R1942:Tmem245 UTSW 4 56923511 unclassified probably benign
R1969:Tmem245 UTSW 4 56937964 missense probably benign 0.01
R2341:Tmem245 UTSW 4 56937957 missense probably damaging 1.00
R2364:Tmem245 UTSW 4 56899391 missense probably damaging 0.96
R4591:Tmem245 UTSW 4 56910204 missense probably damaging 0.99
R4772:Tmem245 UTSW 4 56937989 splice site probably null
R4779:Tmem245 UTSW 4 56936468 missense possibly damaging 0.65
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R5049:Tmem245 UTSW 4 56925057 missense probably benign 0.12
R5061:Tmem245 UTSW 4 56946945 missense possibly damaging 0.94
R5199:Tmem245 UTSW 4 56925149 missense probably benign 0.12
R5377:Tmem245 UTSW 4 56947084 missense probably damaging 0.99
R5547:Tmem245 UTSW 4 56910156 critical splice donor site probably null
R5846:Tmem245 UTSW 4 56903241 missense probably benign 0.00
R5851:Tmem245 UTSW 4 56916770 missense probably benign 0.02
R5991:Tmem245 UTSW 4 56916733 missense probably damaging 1.00
R6314:Tmem245 UTSW 4 56888592 missense possibly damaging 0.88
R6992:Tmem245 UTSW 4 56937940 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGTGGTGTAAGAGAGCAGTC -3'
(R):5'- ATGTCCGGAACAAGCAGCTG -3'

Sequencing Primer
(F):5'- GCAAGCCTGGTCTCCACTCTG -3'
(R):5'- CGGAACAAGCAGCTGATGATTTTG -3'
Posted On2015-04-06