Incidental Mutation 'R3848:Nek1'
ID275763
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 040896-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61072315 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 596 (F596I)
Ref Sequence ENSEMBL: ENSMUSP00000147809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably damaging
Transcript: ENSMUST00000034065
AA Change: F524I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: F524I

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120689
AA Change: F552I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: F552I

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142601
SMART Domains Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
coiled coil region 162 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209845
Predicted Effect probably damaging
Transcript: ENSMUST00000211256
AA Change: F499I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211672
AA Change: F596I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGTCATAATTTTGCCCCATAACTG -3'
(R):5'- AAGCCTGGCAGTTTGAACTC -3'

Sequencing Primer
(F):5'- ATAATTTTGCCCCATAACTGTTACTC -3'
(R):5'- GGCAGTTTGAACTCCTTCACTTAAG -3'
Posted On2015-04-06