Incidental Mutation 'R3848:Hsf4'
ID275766
Institutional Source Beutler Lab
Gene Symbol Hsf4
Ensembl Gene ENSMUSG00000033249
Gene Nameheat shock transcription factor 4
Synonymsldis1
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105269801-105275845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105270837 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 101 (F101L)
Ref Sequence ENSEMBL: ENSMUSP00000134477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect probably damaging
Transcript: ENSMUST00000036127
AA Change: F101L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249
AA Change: F101L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000036221
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163734
AA Change: F41L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249
AA Change: F41L

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172525
AA Change: F101L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249
AA Change: F101L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably damaging
Transcript: ENSMUST00000173640
AA Change: F101L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249
AA Change: F101L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000173859
AA Change: F101L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249
AA Change: F101L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174837
AA Change: F101L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249
AA Change: F101L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal lens morphology and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Hsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Hsf4 APN 8 105275657 makesense probably null
IGL01702:Hsf4 APN 8 105271589 missense probably damaging 1.00
IGL02040:Hsf4 APN 8 105275667 unclassified probably benign
R0115:Hsf4 UTSW 8 105272704 critical splice acceptor site probably null
R0449:Hsf4 UTSW 8 105275590 missense probably benign 0.04
R0585:Hsf4 UTSW 8 105271031 missense probably damaging 1.00
R1365:Hsf4 UTSW 8 105271094 missense probably damaging 0.99
R1401:Hsf4 UTSW 8 105275603 missense probably benign
R2276:Hsf4 UTSW 8 105269996 missense probably null 0.91
R2278:Hsf4 UTSW 8 105269996 missense probably null 0.91
R3850:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R4240:Hsf4 UTSW 8 105274881 missense possibly damaging 0.58
R4781:Hsf4 UTSW 8 105274752 critical splice donor site probably null
R4790:Hsf4 UTSW 8 105270605 missense probably damaging 1.00
R4917:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4918:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4930:Hsf4 UTSW 8 105272698 splice site probably null
R5110:Hsf4 UTSW 8 105272795 missense probably benign 0.01
R5189:Hsf4 UTSW 8 105271428 frame shift probably null
R6001:Hsf4 UTSW 8 105272909 missense possibly damaging 0.70
R6167:Hsf4 UTSW 8 105270849 missense probably damaging 1.00
R6802:Hsf4 UTSW 8 105274668 missense probably damaging 1.00
R7231:Hsf4 UTSW 8 105272147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGTCCCTTTGCCAAGC -3'
(R):5'- AAAGCTTGCACCTCTCCCAG -3'

Sequencing Primer
(F):5'- CTTTGCCAAGCGGGGAGTG -3'
(R):5'- ACGCCATCGACTGTCATCG -3'
Posted On2015-04-06