Incidental Mutation 'R3849:Rnf103'
ID275809
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Namering finger protein 103
SynonymsZfp103, kf-1
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71493894-71510881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 71508875 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 163 (C163W)
Ref Sequence ENSEMBL: ENSMUSP00000109817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
Predicted Effect probably damaging
Transcript: ENSMUST00000064637
AA Change: C163W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: C163W

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114178
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114179
AA Change: C163W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: C163W

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150069
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71509749 missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71509083 missense probably benign 0.00
IGL01601:Rnf103 APN 6 71509183 missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71510382 missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71509564 missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71510188 missense probably benign 0.01
IGL02386:Rnf103 APN 6 71509218 missense probably benign
IGL02532:Rnf103 APN 6 71509825 missense probably benign 0.19
IGL02532:Rnf103 APN 6 71509652 missense probably damaging 0.96
IGL02747:Rnf103 APN 6 71509177 missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71509705 missense probably benign 0.41
IGL03247:Rnf103 APN 6 71510305 missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71509331 missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71509702 missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71509582 missense probably damaging 0.96
R1428:Rnf103 UTSW 6 71508999 missense probably damaging 1.00
R2362:Rnf103 UTSW 6 71510017 missense probably benign 0.08
R3847:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3919:Rnf103 UTSW 6 71510347 missense probably benign 0.08
R4914:Rnf103 UTSW 6 71510264 missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71510008 missense probably benign 0.04
R5634:Rnf103 UTSW 6 71509617 missense probably benign 0.01
R5682:Rnf103 UTSW 6 71508724 intron probably benign
R5791:Rnf103 UTSW 6 71508925 missense probably damaging 0.99
R5994:Rnf103 UTSW 6 71496910 missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71505824 missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71510365 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAACTTGCTTGTTCTGGCAC -3'
(R):5'- TTGGTCAAGGTTTGCAAATAGG -3'

Sequencing Primer
(F):5'- GAGGGTTTTAAAAGGGCC -3'
(R):5'- ACCCAGTATTGATCACTTTTATTCC -3'
Posted On2015-04-06