Incidental Mutation 'R3849:BC017158'
ID275820
Institutional Source Beutler Lab
Gene Symbol BC017158
Ensembl Gene ENSMUSG00000030780
Gene NamecDNA sequence BC017158
SynonymsMGC:28903
MMRRC Submission 040897-MU
Accession Numbers

Genbank: NM_145590; MGI: 2384572

Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128271379-128298170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128285208 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 201 (V201I)
Ref Sequence ENSEMBL: ENSMUSP00000033044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000126263] [ENSMUST00000137677]
Predicted Effect probably damaging
Transcript: ENSMUST00000033044
AA Change: V201I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780
AA Change: V201I

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124216
Predicted Effect probably damaging
Transcript: ENSMUST00000126263
AA Change: V201I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780
AA Change: V201I

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137677
SMART Domains Protein: ENSMUSP00000117520
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 1 64 4.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175474
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative transmembrane protein containing a conserved DUF647 domain that may be involved in protein-protein interaction. The encoded protein is related to a plant protein that participates in ultraviolet B light-sensing during root morphogenesis. [provided by RefSeq, Feb 2013]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in BC017158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:BC017158 APN 7 128276410 missense probably damaging 1.00
IGL02527:BC017158 APN 7 128276231 missense possibly damaging 0.92
IGL02572:BC017158 APN 7 128290580 splice site probably benign
3-1:BC017158 UTSW 7 128276129 missense possibly damaging 0.87
PIT4445001:BC017158 UTSW 7 128276534 missense probably benign 0.15
R0364:BC017158 UTSW 7 128290614 missense probably damaging 1.00
R0590:BC017158 UTSW 7 128297470 missense probably damaging 1.00
R0616:BC017158 UTSW 7 128272631 intron probably null
R2060:BC017158 UTSW 7 128288331 missense probably damaging 1.00
R4487:BC017158 UTSW 7 128288358 missense probably damaging 1.00
R4510:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4511:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4708:BC017158 UTSW 7 128274680 missense probably benign 0.00
R4793:BC017158 UTSW 7 128288202 intron probably benign
R4983:BC017158 UTSW 7 128276473 unclassified probably benign
R5502:BC017158 UTSW 7 128285136 missense probably damaging 1.00
R6181:BC017158 UTSW 7 128297460 critical splice donor site probably null
R6312:BC017158 UTSW 7 128273543 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTACTTCTAAACTGTGGCGAG -3'
(R):5'- TCACAGGGTAATAATGGCTGG -3'

Sequencing Primer
(F):5'- TTCTAAACTGTGGCGAGCCCTG -3'
(R):5'- TAATAATGGCTGGCGAGACTTCCC -3'
Posted On2015-04-06