Incidental Mutation 'R3849:Nek1'
ID275822
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 040897-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61072315 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 596 (F596I)
Ref Sequence ENSEMBL: ENSMUSP00000147809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably damaging
Transcript: ENSMUST00000034065
AA Change: F524I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: F524I

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120689
AA Change: F552I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: F552I

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142601
SMART Domains Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
coiled coil region 162 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209845
Predicted Effect probably damaging
Transcript: ENSMUST00000211256
AA Change: F499I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211672
AA Change: F596I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTGTCATAATTTTGCCCCATAAC -3'
(R):5'- CTGGCAGTTTGAACTCCTTCAC -3'

Sequencing Primer
(F):5'- TCATAATTTTGCCCCATAACTGTTAC -3'
(R):5'- GGCAGTTTGAACTCCTTCACTTAAG -3'
Posted On2015-04-06