Incidental Mutation 'R3850:Cacna2d3'
ID275892
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 3
Synonymsalpha2delta3, alpha 2 delta-3
MMRRC Submission 040898-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3850 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location28904943-29721864 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 29347120 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225733] [ENSMUST00000225863]
Predicted Effect probably null
Transcript: ENSMUST00000022567
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225733
Predicted Effect probably benign
Transcript: ENSMUST00000225863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225953
Meta Mutation Damage Score 0.49 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik G A 18: 35,728,714 V84I probably benign Het
Abca1 C T 4: 53,061,481 probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Antxrl C A 14: 34,067,381 H309Q probably benign Het
Ap1g2 T C 14: 55,104,906 M165V probably benign Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 D331G probably damaging Het
Csmd1 C G 8: 16,079,922 V1729L probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Cwf19l1 T C 19: 44,131,498 Y68C probably benign Het
Dst C T 1: 34,189,274 Q1658* probably null Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Hydin T C 8: 110,563,929 I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 R123H probably benign Het
Mov10l1 A T 15: 89,005,695 probably null Het
Mrc2 T C 11: 105,292,903 probably null Het
Muc5b G A 7: 141,862,638 C3107Y possibly damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nfasc T C 1: 132,631,733 T214A probably damaging Het
Olfr1107 T A 2: 87,071,966 H56L possibly damaging Het
Olfr1245 T C 2: 89,575,034 R231G probably damaging Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pcdhga10 C T 18: 37,749,021 P612S probably damaging Het
Picalm A G 7: 90,191,704 N456S probably damaging Het
Pigo A G 4: 43,025,084 F5S probably benign Het
Pikfyve T C 1: 65,230,845 F563S probably damaging Het
Plod2 A G 9: 92,542,545 E29G probably benign Het
Pm20d2 A G 4: 33,174,414 V403A probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rb1cc1 T A 1: 6,250,113 V1252D probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rmdn3 A T 2: 119,156,422 H41Q possibly damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Ror1 A G 4: 100,442,160 Y910C possibly damaging Het
Scn2a C T 2: 65,682,031 L171F probably benign Het
Sh3pxd2b A G 11: 32,411,505 E239G probably damaging Het
Snx27 G T 3: 94,520,235 T311K probably benign Het
Sspo T A 6: 48,492,490 L4459Q probably damaging Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thap12 G T 7: 98,716,663 K679N probably damaging Het
Vmn2r65 T A 7: 84,946,651 H275L probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zfp229 C A 17: 21,745,862 H358N probably damaging Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 29045644 missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29467949 missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28943555 critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28908321 missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7009:Cacna2d3 UTSW 14 28969365 start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGACACTGTTTGCTTGGCG -3'
(R):5'- CCAGAGATGGATGAGCAGTC -3'

Sequencing Primer
(F):5'- GATGGTCAAGCGGAGTCCTTTC -3'
(R):5'- AGCTGCTGCATTGTGCC -3'
Posted On2015-04-06