Incidental Mutation 'R3850:Rnf17'
ID275895
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 040898-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R3850 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56512296 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1433 (V1433A)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793]
Predicted Effect probably damaging
Transcript: ENSMUST00000095793
AA Change: V1433A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: V1433A

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000225737
AA Change: V46A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik G A 18: 35,728,714 V84I probably benign Het
Abca1 C T 4: 53,061,481 probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Antxrl C A 14: 34,067,381 H309Q probably benign Het
Ap1g2 T C 14: 55,104,906 M165V probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 D331G probably damaging Het
Csmd1 C G 8: 16,079,922 V1729L probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Cwf19l1 T C 19: 44,131,498 Y68C probably benign Het
Dst C T 1: 34,189,274 Q1658* probably null Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Hydin T C 8: 110,563,929 I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 R123H probably benign Het
Mov10l1 A T 15: 89,005,695 probably null Het
Mrc2 T C 11: 105,292,903 probably null Het
Muc5b G A 7: 141,862,638 C3107Y possibly damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nfasc T C 1: 132,631,733 T214A probably damaging Het
Olfr1107 T A 2: 87,071,966 H56L possibly damaging Het
Olfr1245 T C 2: 89,575,034 R231G probably damaging Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pcdhga10 C T 18: 37,749,021 P612S probably damaging Het
Picalm A G 7: 90,191,704 N456S probably damaging Het
Pigo A G 4: 43,025,084 F5S probably benign Het
Pikfyve T C 1: 65,230,845 F563S probably damaging Het
Plod2 A G 9: 92,542,545 E29G probably benign Het
Pm20d2 A G 4: 33,174,414 V403A probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rb1cc1 T A 1: 6,250,113 V1252D probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rmdn3 A T 2: 119,156,422 H41Q possibly damaging Het
Ror1 A G 4: 100,442,160 Y910C possibly damaging Het
Scn2a C T 2: 65,682,031 L171F probably benign Het
Sh3pxd2b A G 11: 32,411,505 E239G probably damaging Het
Snx27 G T 3: 94,520,235 T311K probably benign Het
Sspo T A 6: 48,492,490 L4459Q probably damaging Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thap12 G T 7: 98,716,663 K679N probably damaging Het
Vmn2r65 T A 7: 84,946,651 H275L probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zfp229 C A 17: 21,745,862 H358N probably damaging Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 unclassified probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGTACACAGAAGAGCTTGTTTTG -3'
(R):5'- TATGCAAATAAGGAGCACAACTCTG -3'

Sequencing Primer
(F):5'- ACACAGAAGAGCTTGTTTTGTGGTAG -3'
(R):5'- CTCTGGAAAATCAGCAGGTGC -3'
Posted On2015-04-06