Incidental Mutation 'R3850:Hoxc10'
ID275897
Institutional Source Beutler Lab
Gene Symbol Hoxc10
Ensembl Gene ENSMUSG00000022484
Gene Namehomeobox C10
SynonymsHox-3.6
MMRRC Submission 040898-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3850 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102966796-102971893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102967444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000001699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001699]
Predicted Effect probably benign
Transcript: ENSMUST00000001699
AA Change: V196A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001699
Gene: ENSMUSG00000022484
AA Change: V196A

DomainStartEndE-ValueType
low complexity region 143 157 N/A INTRINSIC
HOX 268 330 2.68e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The protein level is controlled during cell differentiation and proliferation, which may indicate this protein has a role in origin activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit skeletal transformations in thoracic, lumbar and sacral vertebrae, alterations in the pelvis and in the bones and ligaments of the hindlimb, femoral defects, decreased lumbar motor neuron and rib number, impairedcoordination, muscle wasting, and obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik G A 18: 35,728,714 V84I probably benign Het
Abca1 C T 4: 53,061,481 probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Antxrl C A 14: 34,067,381 H309Q probably benign Het
Ap1g2 T C 14: 55,104,906 M165V probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 D331G probably damaging Het
Csmd1 C G 8: 16,079,922 V1729L probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Cwf19l1 T C 19: 44,131,498 Y68C probably benign Het
Dst C T 1: 34,189,274 Q1658* probably null Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Hydin T C 8: 110,563,929 I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 R123H probably benign Het
Mov10l1 A T 15: 89,005,695 probably null Het
Mrc2 T C 11: 105,292,903 probably null Het
Muc5b G A 7: 141,862,638 C3107Y possibly damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nfasc T C 1: 132,631,733 T214A probably damaging Het
Olfr1107 T A 2: 87,071,966 H56L possibly damaging Het
Olfr1245 T C 2: 89,575,034 R231G probably damaging Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pcdhga10 C T 18: 37,749,021 P612S probably damaging Het
Picalm A G 7: 90,191,704 N456S probably damaging Het
Pigo A G 4: 43,025,084 F5S probably benign Het
Pikfyve T C 1: 65,230,845 F563S probably damaging Het
Plod2 A G 9: 92,542,545 E29G probably benign Het
Pm20d2 A G 4: 33,174,414 V403A probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rb1cc1 T A 1: 6,250,113 V1252D probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rmdn3 A T 2: 119,156,422 H41Q possibly damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Ror1 A G 4: 100,442,160 Y910C possibly damaging Het
Scn2a C T 2: 65,682,031 L171F probably benign Het
Sh3pxd2b A G 11: 32,411,505 E239G probably damaging Het
Snx27 G T 3: 94,520,235 T311K probably benign Het
Sspo T A 6: 48,492,490 L4459Q probably damaging Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thap12 G T 7: 98,716,663 K679N probably damaging Het
Vmn2r65 T A 7: 84,946,651 H275L probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zfp229 C A 17: 21,745,862 H358N probably damaging Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Hoxc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:Hoxc10 UTSW 15 102967482 missense probably benign 0.07
R1529:Hoxc10 UTSW 15 102967200 missense probably damaging 1.00
R1771:Hoxc10 UTSW 15 102967087 missense probably damaging 1.00
R2139:Hoxc10 UTSW 15 102967477 missense probably benign 0.19
R2962:Hoxc10 UTSW 15 102967300 missense probably damaging 1.00
R3849:Hoxc10 UTSW 15 102967444 missense probably benign 0.00
R4507:Hoxc10 UTSW 15 102966952 missense probably damaging 1.00
R4650:Hoxc10 UTSW 15 102967263 missense probably benign 0.02
R5640:Hoxc10 UTSW 15 102967267 missense probably benign 0.39
R5951:Hoxc10 UTSW 15 102967318 missense possibly damaging 0.52
R6240:Hoxc10 UTSW 15 102970830 missense probably damaging 1.00
R6899:Hoxc10 UTSW 15 102967507 missense possibly damaging 0.83
R7110:Hoxc10 UTSW 15 102970921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCATGTACAGTGCAGAG -3'
(R):5'- GACGGCCTTACCTTTAGCTTCG -3'

Sequencing Primer
(F):5'- AGTCTTGCCTTGGGGAGCAC -3'
(R):5'- CGTTATCCGAGGTGTCTGGAC -3'
Posted On2015-04-06