Incidental Mutation 'R3850:Rimbp3'
ID275899
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene NameRIMS binding protein 3
SynonymsRIM-BP3, LOC239731, LOC385766
MMRRC Submission 040898-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R3850 (G1)
Quality Score199
Status Validated
Chromosome16
Chromosomal Location17208603-17213982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17210299 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 529 (H529L)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
Predicted Effect probably benign
Transcript: ENSMUST00000169803
AA Change: H529L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: H529L

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179034
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik G A 18: 35,728,714 V84I probably benign Het
Abca1 C T 4: 53,061,481 probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Antxrl C A 14: 34,067,381 H309Q probably benign Het
Ap1g2 T C 14: 55,104,906 M165V probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 D331G probably damaging Het
Csmd1 C G 8: 16,079,922 V1729L probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Cwf19l1 T C 19: 44,131,498 Y68C probably benign Het
Dst C T 1: 34,189,274 Q1658* probably null Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Hydin T C 8: 110,563,929 I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 R123H probably benign Het
Mov10l1 A T 15: 89,005,695 probably null Het
Mrc2 T C 11: 105,292,903 probably null Het
Muc5b G A 7: 141,862,638 C3107Y possibly damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nfasc T C 1: 132,631,733 T214A probably damaging Het
Olfr1107 T A 2: 87,071,966 H56L possibly damaging Het
Olfr1245 T C 2: 89,575,034 R231G probably damaging Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pcdhga10 C T 18: 37,749,021 P612S probably damaging Het
Picalm A G 7: 90,191,704 N456S probably damaging Het
Pigo A G 4: 43,025,084 F5S probably benign Het
Pikfyve T C 1: 65,230,845 F563S probably damaging Het
Plod2 A G 9: 92,542,545 E29G probably benign Het
Pm20d2 A G 4: 33,174,414 V403A probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rb1cc1 T A 1: 6,250,113 V1252D probably benign Het
Rmdn3 A T 2: 119,156,422 H41Q possibly damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Ror1 A G 4: 100,442,160 Y910C possibly damaging Het
Scn2a C T 2: 65,682,031 L171F probably benign Het
Sh3pxd2b A G 11: 32,411,505 E239G probably damaging Het
Snx27 G T 3: 94,520,235 T311K probably benign Het
Sspo T A 6: 48,492,490 L4459Q probably damaging Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thap12 G T 7: 98,716,663 K679N probably damaging Het
Vmn2r65 T A 7: 84,946,651 H275L probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zfp229 C A 17: 21,745,862 H358N probably damaging Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCTACAGATCGAAGCATTGAGG -3'
(R):5'- ATTCTCCTCTGACAGCCTGG -3'

Sequencing Primer
(F):5'- CATTGAGGCGGGAGTGC -3'
(R):5'- ACAGCCTGGCGCCTTTG -3'
Posted On2015-04-06