Incidental Mutation 'R3852:Olfr585'
ID275973
Institutional Source Beutler Lab
Gene Symbol Olfr585
Ensembl Gene ENSMUSG00000078080
Gene Nameolfactory receptor 585
SynonymsMOR14-4, GA_x6K02T2PBJ9-5809085-5810035
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103097720-103098749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103098184 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 148 (S148P)
Ref Sequence ENSEMBL: ENSMUSP00000100476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104881]
Predicted Effect probably damaging
Transcript: ENSMUST00000104881
AA Change: S148P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100476
Gene: ENSMUSG00000078080
AA Change: S148P

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 45 315 5.9e-6 PFAM
Pfam:7tm_1 50 300 7.9e-23 PFAM
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Olfr585
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Olfr585 APN 7 103097870 missense probably damaging 1.00
IGL02866:Olfr585 APN 7 103098383 missense probably damaging 0.99
FR4548:Olfr585 UTSW 7 103098309 nonsense probably null
FR4976:Olfr585 UTSW 7 103098309 small insertion probably benign
R0893:Olfr585 UTSW 7 103098434 missense probably benign 0.01
R0926:Olfr585 UTSW 7 103097885 missense probably damaging 1.00
R1486:Olfr585 UTSW 7 103098430 missense probably damaging 1.00
R2031:Olfr585 UTSW 7 103098164 missense probably damaging 0.98
R4849:Olfr585 UTSW 7 103098319 missense possibly damaging 0.95
R5241:Olfr585 UTSW 7 103098317 missense probably benign 0.36
R5668:Olfr585 UTSW 7 103097896 missense probably benign 0.42
R5841:Olfr585 UTSW 7 103097954 missense probably damaging 1.00
R6902:Olfr585 UTSW 7 103098355 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTTGAGAATCCTGTGGTTTCAG -3'
(R):5'- ACAATGCAGGGAATATCTAGCCC -3'

Sequencing Primer
(F):5'- CCTGTGGTTTCAGGCAAATG -3'
(R):5'- TAGCCCTGTCGTCAGAATGAGATC -3'
Posted On2015-04-06