Incidental Mutation 'R3853:Scn4a'
ID276024
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission 040900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3853 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106320106 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1695 (M1695K)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021056
AA Change: M1695K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: M1695K

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,346 H316L probably damaging Het
AI481877 T C 4: 59,047,390 N1410D possibly damaging Het
Cadps A G 14: 12,509,090 probably benign Het
Cluh A G 11: 74,656,453 D44G probably benign Het
Copb1 A G 7: 114,223,316 V726A probably damaging Het
Dsg4 T C 18: 20,449,234 V79A probably benign Het
Exo1 A T 1: 175,892,988 I291F probably benign Het
Eya4 C T 10: 23,116,676 A460T probably damaging Het
Gjc1 G T 11: 102,800,126 D350E probably benign Het
Hcar2 T C 5: 123,864,412 M343V probably benign Het
Ifna15 T C 4: 88,557,809 Y146C probably damaging Het
Lce3e C T 3: 92,967,832 Q32* probably null Het
Llgl1 T C 11: 60,707,249 L373P probably damaging Het
Mark2 A G 19: 7,277,290 C642R probably damaging Het
Mbd3l2 A G 9: 18,444,796 Q139R probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mum1l1 C T X: 139,236,654 probably null Het
Nynrin T A 14: 55,864,105 N410K probably benign Het
Olfr1243 A T 2: 89,527,573 M279K possibly damaging Het
Olfr1354 T A 10: 78,916,947 Y36N probably damaging Het
Olfr1466 A G 19: 13,342,498 T247A possibly damaging Het
Olfr906 G T 9: 38,488,951 R307S probably benign Het
Olfr978 A T 9: 39,994,154 T115S probably damaging Het
Padi3 T C 4: 140,791,269 probably benign Het
Prkce A G 17: 86,168,849 D86G probably damaging Het
Rad21 T G 15: 51,972,316 I234L probably benign Het
Sdccag8 T C 1: 176,853,795 S325P probably damaging Het
Sebox G A 11: 78,504,149 G106R probably benign Het
Serpinb9 A G 13: 33,015,520 E266G possibly damaging Het
Snx14 T C 9: 88,407,319 probably benign Het
Tmc6 A T 11: 117,773,058 L474* probably null Het
Tmem132c T C 5: 127,359,869 Y141H probably benign Het
Trap1 G A 16: 4,054,822 R328C possibly damaging Het
Trim36 C A 18: 46,172,372 probably benign Het
Trmt2a A T 16: 18,251,191 Y299F possibly damaging Het
Trrap A G 5: 144,792,165 K630E probably damaging Het
Tsnaxip1 A T 8: 105,840,701 probably benign Het
Ttc6 G T 12: 57,728,549 C1677F possibly damaging Het
Ugt2a3 A T 5: 87,337,159 V2D possibly damaging Het
Usp9x A G X: 13,098,583 D77G probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zan A C 5: 137,474,064 L140R probably damaging Het
Zc3h3 A T 15: 75,837,497 S508T probably benign Het
Zswim3 A G 2: 164,820,857 Y419C possibly damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 intron probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGGCGGTACATGTAAGAG -3'
(R):5'- ACCTGGGAGAAGTTTGACCC -3'

Sequencing Primer
(F):5'- ATGTAAGAGGCCTGCTTCAC -3'
(R):5'- AGAAGTTTGACCCCGATGC -3'
Posted On2015-04-06