Mutagenetix > Incidental Mutation

Incidental Mutation 'R3854:C2cd3'

276062

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

041605-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3854 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100021440-100119359 bp(+) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 100103808 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000098259] [ENSMUST00000120196] [ENSMUST00000120196]

AlphaFold

Q52KB6

Predicted Effect

probably null
Transcript: ENSMUST00000051777

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000051777

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000098259

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000098259

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119647

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120196

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120196

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184420

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184657

Predicted Effect

probably benign
Transcript: ENSMUST00000185084

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193553

Meta Mutation Damage Score

0.9504

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.2%
20x: 94.2%

Validation Efficiency

96% (46/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1	T	C	2: 58,352,946 (GRCm39)	K338R	probably damaging	Het
Adar	C	T	3: 89,643,565 (GRCm39)	P482L	probably damaging	Het
Adh5	A	G	3: 138,156,776 (GRCm39)	D154G	probably benign	Het
Apoa1	A	G	9: 46,141,521 (GRCm39)	S206G	probably benign	Het
Aspdh	T	C	7: 44,115,613 (GRCm39)	V5A	possibly damaging	Het
Bend3	AAGGACCA	AA	10: 43,386,713 (GRCm39)		probably benign	Het
Ccdc87	A	G	19: 4,889,546 (GRCm39)	I13V	probably benign	Het
Cd163	A	T	6: 124,288,525 (GRCm39)	N319Y	probably damaging	Het
Cdc42bpa	A	G	1: 179,983,543 (GRCm39)		probably benign	Het
Ceacam2	T	C	7: 25,238,227 (GRCm39)	S66G	probably benign	Het
Cep131	G	A	11: 119,958,011 (GRCm39)	R772*	probably null	Het
Clhc1	T	C	11: 29,521,789 (GRCm39)	C441R	probably damaging	Het
Clstn2	G	A	9: 97,345,648 (GRCm39)	Q567*	probably null	Het
Cops7a	C	T	6: 124,936,795 (GRCm39)	R252H	probably damaging	Het
Daam2	T	C	17: 49,765,624 (GRCm39)	N1093S	probably benign	Het
Dnajc16	G	A	4: 141,490,964 (GRCm39)	R729*	probably null	Het
Eml6	C	T	11: 29,699,905 (GRCm39)	A1744T	possibly damaging	Het
Fam43b	G	C	4: 138,122,409 (GRCm39)	R304G	probably benign	Het
Fbll1	T	A	11: 35,688,526 (GRCm39)	T246S	probably benign	Het
Fbln2	A	T	6: 91,243,353 (GRCm39)	T910S	probably damaging	Het
Fcna	C	T	2: 25,517,784 (GRCm39)	G22D	possibly damaging	Het
Gadl1	G	T	9: 115,835,732 (GRCm39)	E387*	probably null	Het
Gm5592	G	A	7: 40,807,259 (GRCm39)		probably benign	Het
Gpr82	A	T	X: 13,531,577 (GRCm39)	T42S	probably benign	Het
Hk2	T	C	6: 82,713,657 (GRCm39)	E447G	possibly damaging	Het
Idi1	G	T	13: 8,935,968 (GRCm39)	A25S	probably benign	Het
Lbr	G	A	1: 181,659,280 (GRCm39)	T167I	probably benign	Het
Mdh1	C	T	11: 21,509,281 (GRCm39)	V234I	probably benign	Het
Muc2	A	G	7: 141,308,081 (GRCm39)	H420R	probably damaging	Het
Nhlrc2	T	C	19: 56,576,703 (GRCm39)		probably null	Het
Nrcam	G	T	12: 44,622,667 (GRCm39)	A938S	probably benign	Het
Nt5c2	A	G	19: 46,884,957 (GRCm39)	V252A	probably damaging	Het
Or10z1	T	A	1: 174,077,716 (GRCm39)	Y259F	probably damaging	Het
Or1p1c	A	T	11: 74,161,105 (GRCm39)	K297*	probably null	Het
Or51r1	T	G	7: 102,228,227 (GRCm39)	L175R	probably damaging	Het
Pgap3	T	C	11: 98,281,638 (GRCm39)	T187A	possibly damaging	Het
Pus10	T	C	11: 23,653,003 (GRCm39)		probably null	Het
Rnf213	T	C	11: 119,371,765 (GRCm39)		probably benign	Het
Sag	T	C	1: 87,752,240 (GRCm39)		probably benign	Het
Serpinb9e	A	G	13: 33,439,137 (GRCm39)	I188V	probably benign	Het
Shcbp1l	A	T	1: 153,328,190 (GRCm39)	I634F	probably damaging	Het
Slc6a16	T	A	7: 44,917,596 (GRCm39)	C485S	probably damaging	Het
Vmn1r215	A	C	13: 23,260,058 (GRCm39)	M33L	probably benign	Het
Vps26c	A	G	16: 94,311,665 (GRCm39)	F95L	probably benign	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100,040,335 (GRCm39)	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100,104,065 (GRCm39)	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100,092,638 (GRCm39)	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100,076,421 (GRCm39)	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100,023,693 (GRCm39)	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100,068,922 (GRCm39)	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100,076,376 (GRCm39)	unclassified	probably benign
IGL02852:C2cd3	APN	7	100,079,396 (GRCm39)	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100,023,683 (GRCm39)	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100,067,729 (GRCm39)	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100,065,269 (GRCm39)	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0032:C2cd3	UTSW	7	100,093,652 (GRCm39)	unclassified	probably benign
R0124:C2cd3	UTSW	7	100,118,725 (GRCm39)	missense	probably benign
R0387:C2cd3	UTSW	7	100,071,714 (GRCm39)	splice site	probably benign
R0522:C2cd3	UTSW	7	100,044,429 (GRCm39)	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100,071,888 (GRCm39)	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100,089,397 (GRCm39)	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100,055,284 (GRCm39)	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100,021,704 (GRCm39)	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100,056,232 (GRCm39)	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100,104,700 (GRCm39)	unclassified	probably benign
R2060:C2cd3	UTSW	7	100,104,155 (GRCm39)	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100,062,573 (GRCm39)	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100,044,459 (GRCm39)	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100,085,040 (GRCm39)	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100,081,205 (GRCm39)	missense	probably damaging	1.00
R4359:C2cd3	UTSW	7	100,090,296 (GRCm39)	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100,081,306 (GRCm39)	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100,023,684 (GRCm39)	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100,021,657 (GRCm39)	unclassified	probably benign
R4705:C2cd3	UTSW	7	100,044,395 (GRCm39)	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100,092,642 (GRCm39)	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100,065,539 (GRCm39)	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100,040,226 (GRCm39)	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100,065,397 (GRCm39)	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100,104,160 (GRCm39)	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100,062,581 (GRCm39)	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100,055,166 (GRCm39)	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100,109,049 (GRCm39)	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100,092,692 (GRCm39)	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100,039,373 (GRCm39)	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100,104,700 (GRCm39)	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100,093,682 (GRCm39)	unclassified	probably benign
R6110:C2cd3	UTSW	7	100,090,283 (GRCm39)	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100,065,635 (GRCm39)	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100,081,298 (GRCm39)	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100,104,505 (GRCm39)	missense	probably benign
R6613:C2cd3	UTSW	7	100,044,448 (GRCm39)	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100,067,747 (GRCm39)	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100,104,553 (GRCm39)	missense	probably benign
R6837:C2cd3	UTSW	7	100,097,953 (GRCm39)	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100,056,134 (GRCm39)	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100,039,448 (GRCm39)	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100,100,826 (GRCm39)	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100,081,299 (GRCm39)	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100,065,388 (GRCm39)	missense
R7174:C2cd3	UTSW	7	100,081,405 (GRCm39)	missense
R7241:C2cd3	UTSW	7	100,056,257 (GRCm39)	missense
R7335:C2cd3	UTSW	7	100,071,810 (GRCm39)	missense
R7357:C2cd3	UTSW	7	100,079,310 (GRCm39)	missense
R7493:C2cd3	UTSW	7	100,076,433 (GRCm39)	missense
R7567:C2cd3	UTSW	7	100,080,022 (GRCm39)	missense
R7573:C2cd3	UTSW	7	100,068,914 (GRCm39)	missense
R7869:C2cd3	UTSW	7	100,118,698 (GRCm39)	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100,109,096 (GRCm39)	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100,067,711 (GRCm39)	missense
R8369:C2cd3	UTSW	7	100,044,465 (GRCm39)	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100,104,487 (GRCm39)	nonsense	probably null
R8753:C2cd3	UTSW	7	100,049,024 (GRCm39)	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100,104,004 (GRCm39)	missense	probably benign
R8905:C2cd3	UTSW	7	100,074,132 (GRCm39)	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100,040,286 (GRCm39)	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100,068,971 (GRCm39)	missense
R9000:C2cd3	UTSW	7	100,065,281 (GRCm39)	missense
R9064:C2cd3	UTSW	7	100,059,608 (GRCm39)	missense
R9072:C2cd3	UTSW	7	100,040,291 (GRCm39)	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100,081,430 (GRCm39)	missense
R9160:C2cd3	UTSW	7	100,075,236 (GRCm39)	missense
R9234:C2cd3	UTSW	7	100,049,012 (GRCm39)	missense
R9258:C2cd3	UTSW	7	100,098,026 (GRCm39)	missense
R9295:C2cd3	UTSW	7	100,081,734 (GRCm39)	missense
R9411:C2cd3	UTSW	7	100,065,704 (GRCm39)	missense
R9420:C2cd3	UTSW	7	100,065,262 (GRCm39)	missense
R9589:C2cd3	UTSW	7	100,081,756 (GRCm39)	missense
R9628:C2cd3	UTSW	7	100,097,961 (GRCm39)	missense
R9629:C2cd3	UTSW	7	100,029,249 (GRCm39)	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100,023,662 (GRCm39)	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100,076,458 (GRCm39)	missense
X0002:C2cd3	UTSW	7	100,089,442 (GRCm39)	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CTTCCACAGGTGTCTCCACAAC -3'
(R):5'- AATCTGTGCTCGCCTCTATAGC -3'

Sequencing Primer
(F):5'- GTTTCACTGACTCTTGGGT -3'
(R):5'- GCCTCTATAGCTCCTGCCAAAG -3'

Posted On

2015-04-06