Incidental Mutation 'R3855:Dthd1'
ID276104
Institutional Source Beutler Lab
Gene Symbol Dthd1
Ensembl Gene ENSMUSG00000090326
Gene Namedeath domain containing 1
SynonymsGm17384
MMRRC Submission 040901-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R3855 (G1)
Quality Score204
Status Validated
Chromosome5
Chromosomal Location62813823-62888308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62888023 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 710 (V710A)
Ref Sequence ENSEMBL: ENSMUSP00000131534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170704]
Predicted Effect probably benign
Transcript: ENSMUST00000170704
AA Change: V710A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131534
Gene: ENSMUSG00000090326
AA Change: V710A

DomainStartEndE-ValueType
Pfam:Death 693 778 4.2e-12 PFAM
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,373,468 S1144R probably damaging Het
Apbb1ip T C 2: 22,875,175 S623P unknown Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Cog2 T C 8: 124,530,003 probably null Het
Dennd4c G A 4: 86,779,847 V191M probably damaging Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Fam58b T C 11: 78,751,187 N159S probably benign Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm4868 A G 5: 125,848,545 noncoding transcript Het
Gpr179 T C 11: 97,341,434 E648G probably damaging Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Itgb3bp T C 4: 99,798,720 E76G possibly damaging Het
Khk A G 5: 30,927,057 D82G probably benign Het
Kif17 A G 4: 138,291,510 S533G probably benign Het
Kmt2a A G 9: 44,830,499 probably benign Het
Kmt5c T C 7: 4,746,256 F104S probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Nbas T A 12: 13,279,414 I120N possibly damaging Het
Nfia A G 4: 98,063,022 H362R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nme5 A G 18: 34,569,831 S135P possibly damaging Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Nufip2 T C 11: 77,692,889 V543A probably damaging Het
Olfr1380 A G 11: 49,564,091 T57A probably damaging Het
Olfr364-ps1 A T 2: 37,146,823 I204F possibly damaging Het
Otog T C 7: 46,273,760 S1020P possibly damaging Het
Pear1 T C 3: 87,751,921 H814R possibly damaging Het
Pkd1l1 A G 11: 8,965,047 probably null Het
Pla2g4a T A 1: 149,830,177 I711F possibly damaging Het
Ppig G A 2: 69,749,375 V418I unknown Het
Prg4 T C 1: 150,452,000 Y234C probably damaging Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sepsecs G A 5: 52,664,274 R74C probably damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Sox11 C A 12: 27,341,502 G303C probably damaging Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Xylt1 T G 7: 117,593,550 L361R probably damaging Het
Zfp512 A G 5: 31,480,249 R505G possibly damaging Het
Other mutations in Dthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4342:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4589:Dthd1 UTSW 5 62843026 frame shift probably null
FR4976:Dthd1 UTSW 5 62843024 small insertion probably benign
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0395:Dthd1 UTSW 5 62814333 missense possibly damaging 0.71
R0734:Dthd1 UTSW 5 62839410 splice site probably benign
R0899:Dthd1 UTSW 5 62842928 missense probably benign 0.01
R0970:Dthd1 UTSW 5 62887981 missense probably damaging 1.00
R1104:Dthd1 UTSW 5 62821959 missense probably damaging 1.00
R1518:Dthd1 UTSW 5 62822040 missense probably damaging 1.00
R1831:Dthd1 UTSW 5 62827229 missense probably benign 0.02
R2110:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2110:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2112:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2112:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2248:Dthd1 UTSW 5 62849900 missense probably damaging 0.99
R2311:Dthd1 UTSW 5 62839237 splice site probably benign
R2937:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R2938:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R3835:Dthd1 UTSW 5 62849785 missense probably damaging 1.00
R3855:Dthd1 UTSW 5 62827129 missense probably benign 0.21
R4049:Dthd1 UTSW 5 62827165 nonsense probably null
R4321:Dthd1 UTSW 5 62818690 missense probably damaging 0.99
R4353:Dthd1 UTSW 5 62842867 missense probably benign 0.04
R4560:Dthd1 UTSW 5 62827092 missense probably damaging 1.00
R4613:Dthd1 UTSW 5 62827068 missense probably damaging 1.00
R4689:Dthd1 UTSW 5 62842912 missense probably damaging 0.99
R4715:Dthd1 UTSW 5 62888187 missense probably benign
R4718:Dthd1 UTSW 5 62818793 missense probably damaging 1.00
R4967:Dthd1 UTSW 5 62888206 missense probably benign 0.01
R5068:Dthd1 UTSW 5 62818716 missense probably benign
R5089:Dthd1 UTSW 5 62849905 missense probably benign
R5355:Dthd1 UTSW 5 62839387 missense probably damaging 1.00
R5470:Dthd1 UTSW 5 62818766 missense probably damaging 1.00
R6284:Dthd1 UTSW 5 62814041 missense possibly damaging 0.71
R6293:Dthd1 UTSW 5 62842850 missense probably damaging 0.99
R6484:Dthd1 UTSW 5 62814332 missense probably benign 0.34
R6516:Dthd1 UTSW 5 62839264 missense probably benign 0.16
R6741:Dthd1 UTSW 5 62842946 missense probably damaging 1.00
R6810:Dthd1 UTSW 5 62814329 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTATGGGTGGTCTCATAGC -3'
(R):5'- AGCTCTTCTGTGAGATCACCG -3'

Sequencing Primer
(F):5'- AGCTTTCTTTCTCATAGGCTAAAC -3'
(R):5'- GATCACCGCGGCCCATTTTG -3'
Posted On2015-04-06