Incidental Mutation 'R3855:Rnf145'
ID276122
Institutional Source Beutler Lab
Gene Symbol Rnf145
Ensembl Gene ENSMUSG00000019189
Gene Namering finger protein 145
Synonyms3732413I11Rik
MMRRC Submission 040901-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R3855 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location44518964-44565520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44531293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 68 (V68M)
Ref Sequence ENSEMBL: ENSMUSP00000098881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019333] [ENSMUST00000101327]
Predicted Effect probably benign
Transcript: ENSMUST00000019333
AA Change: V68M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019333
Gene: ENSMUSG00000019189
AA Change: V68M

DomainStartEndE-ValueType
Pfam:TRC8_N 8 506 2.8e-156 PFAM
RING 537 574 2.12e-8 SMART
low complexity region 590 601 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101327
AA Change: V68M

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098881
Gene: ENSMUSG00000019189
AA Change: V68M

DomainStartEndE-ValueType
Pfam:TRC8_N 7 266 1.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124959
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A T 4: 63,373,468 S1144R probably damaging Het
Apbb1ip T C 2: 22,875,175 S623P unknown Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Cog2 T C 8: 124,530,003 probably null Het
Dennd4c G A 4: 86,779,847 V191M probably damaging Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Dthd1 T A 5: 62,827,129 H392Q probably benign Het
Dthd1 T C 5: 62,888,023 V710A probably benign Het
Fam58b T C 11: 78,751,187 N159S probably benign Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm4868 A G 5: 125,848,545 noncoding transcript Het
Gpr179 T C 11: 97,341,434 E648G probably damaging Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Itgb3bp T C 4: 99,798,720 E76G possibly damaging Het
Khk A G 5: 30,927,057 D82G probably benign Het
Kif17 A G 4: 138,291,510 S533G probably benign Het
Kmt2a A G 9: 44,830,499 probably benign Het
Kmt5c T C 7: 4,746,256 F104S probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Nbas T A 12: 13,279,414 I120N possibly damaging Het
Nfia A G 4: 98,063,022 H362R probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nme5 A G 18: 34,569,831 S135P possibly damaging Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Nufip2 T C 11: 77,692,889 V543A probably damaging Het
Olfr1380 A G 11: 49,564,091 T57A probably damaging Het
Olfr364-ps1 A T 2: 37,146,823 I204F possibly damaging Het
Otog T C 7: 46,273,760 S1020P possibly damaging Het
Pear1 T C 3: 87,751,921 H814R possibly damaging Het
Pkd1l1 A G 11: 8,965,047 probably null Het
Pla2g4a T A 1: 149,830,177 I711F possibly damaging Het
Ppig G A 2: 69,749,375 V418I unknown Het
Prg4 T C 1: 150,452,000 Y234C probably damaging Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Sepsecs G A 5: 52,664,274 R74C probably damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Sox11 C A 12: 27,341,502 G303C probably damaging Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Xylt1 T G 7: 117,593,550 L361R probably damaging Het
Zfp512 A G 5: 31,480,249 R505G possibly damaging Het
Other mutations in Rnf145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rnf145 APN 11 44555212 missense possibly damaging 0.90
IGL02972:Rnf145 APN 11 44564038 missense probably benign 0.26
IGL03168:Rnf145 APN 11 44555158 missense probably damaging 1.00
IGL03185:Rnf145 APN 11 44531330 missense probably damaging 1.00
IGL02980:Rnf145 UTSW 11 44561657 missense probably benign
R0112:Rnf145 UTSW 11 44564151 missense probably benign
R0346:Rnf145 UTSW 11 44555164 missense probably damaging 1.00
R0415:Rnf145 UTSW 11 44525138 missense probably damaging 0.99
R0452:Rnf145 UTSW 11 44561760 missense probably damaging 1.00
R0487:Rnf145 UTSW 11 44555229 missense probably benign 0.21
R0598:Rnf145 UTSW 11 44548943 missense probably damaging 1.00
R0631:Rnf145 UTSW 11 44560024 missense probably damaging 0.99
R0837:Rnf145 UTSW 11 44524988 missense probably benign 0.00
R1611:Rnf145 UTSW 11 44551798 missense probably damaging 1.00
R1971:Rnf145 UTSW 11 44548815 missense probably damaging 1.00
R1991:Rnf145 UTSW 11 44561466 missense possibly damaging 0.90
R2157:Rnf145 UTSW 11 44555170 missense probably damaging 1.00
R2340:Rnf145 UTSW 11 44531378 missense probably benign 0.04
R4483:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R4564:Rnf145 UTSW 11 44548808 missense probably benign 0.25
R4922:Rnf145 UTSW 11 44557236 unclassified probably benign
R5633:Rnf145 UTSW 11 44560088 missense probably damaging 1.00
R5672:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5673:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5701:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5915:Rnf145 UTSW 11 44542722 critical splice donor site probably null
R6128:Rnf145 UTSW 11 44555191 missense probably damaging 1.00
R6502:Rnf145 UTSW 11 44525105 missense probably damaging 0.98
R6717:Rnf145 UTSW 11 44561490 missense probably benign 0.00
R6963:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R7035:Rnf145 UTSW 11 44561756 missense probably damaging 1.00
R7154:Rnf145 UTSW 11 44524995 missense probably damaging 1.00
R7351:Rnf145 UTSW 11 44548796 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTGCTGCAGCTAATTATAAAGCAG -3'
(R):5'- GCAACCTACCTAAGCCTTAACTTTG -3'

Sequencing Primer
(F):5'- CTAATTATAAAGCAGAAAGATGGCGC -3'
(R):5'- ACACTATGTTGACATTAAAAACCAAC -3'
Posted On2015-04-06