Incidental Mutation 'R3856:Prmt9'
ID276166
Institutional Source Beutler Lab
Gene Symbol Prmt9
Ensembl Gene ENSMUSG00000037134
Gene Nameprotein arginine methyltransferase 9
SynonymsPrmt10
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location77549397-77581338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77568265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 413 (V413I)
Ref Sequence ENSEMBL: ENSMUSP00000112692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056237] [ENSMUST00000118622] [ENSMUST00000210040]
Predicted Effect probably benign
Transcript: ENSMUST00000056237
AA Change: V413I

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050181
Gene: ENSMUSG00000037134
AA Change: V413I

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_11 67 132 1.2e-7 PFAM
Pfam:TPR_2 102 134 7.9e-5 PFAM
Pfam:PrmA 168 257 2.5e-10 PFAM
internal_repeat_1 585 836 1.37e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000118622
AA Change: V413I

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112692
Gene: ENSMUSG00000037134
AA Change: V413I

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_2 102 134 3e-5 PFAM
Pfam:PrmA 168 257 4.9e-10 PFAM
internal_repeat_1 585 836 1.05e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157125
Predicted Effect probably benign
Transcript: ENSMUST00000210040
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Prmt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Prmt9 APN 8 77562440 missense probably damaging 1.00
IGL02306:Prmt9 APN 8 77560818 missense probably benign 0.06
IGL02971:Prmt9 APN 8 77565069 missense probably benign 0.00
1mM(1):Prmt9 UTSW 8 77555764 missense probably benign 0.01
R0004:Prmt9 UTSW 8 77555782 missense possibly damaging 0.81
R0928:Prmt9 UTSW 8 77581176 missense probably damaging 1.00
R1328:Prmt9 UTSW 8 77572654 missense possibly damaging 0.86
R1777:Prmt9 UTSW 8 77565108 missense probably benign 0.05
R1826:Prmt9 UTSW 8 77555674 nonsense probably null
R1925:Prmt9 UTSW 8 77577339 missense possibly damaging 0.52
R3855:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R4089:Prmt9 UTSW 8 77572545 missense probably benign 0.00
R4963:Prmt9 UTSW 8 77555729 missense probably damaging 1.00
R5196:Prmt9 UTSW 8 77564997 missense probably benign 0.30
R5413:Prmt9 UTSW 8 77572009 missense possibly damaging 0.95
R5975:Prmt9 UTSW 8 77561018 intron probably benign
R6271:Prmt9 UTSW 8 77577463 missense probably damaging 0.96
R7023:Prmt9 UTSW 8 77549457 start gained probably benign
R7107:Prmt9 UTSW 8 77568251 missense possibly damaging 0.62
X0027:Prmt9 UTSW 8 77560883 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGAAGGAAACGCACAGTCAGT -3'
(R):5'- TTGGTCACTGACAGTTACTTGA -3'

Sequencing Primer
(F):5'- GCTGTCTTCAGATACTCCAGAAGAG -3'
(R):5'- TAGGTATCACGGGTCCTCTAGAAC -3'
Posted On2015-04-06