Incidental Mutation 'R3856:Atxn7l3'
ID276173
Institutional Source Beutler Lab
Gene Symbol Atxn7l3
Ensembl Gene ENSMUSG00000059995
Gene Nameataxin 7-like 3
Synonyms
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R3856 (G1)
Quality Score220
Status Validated
Chromosome11
Chromosomal Location102289300-102296631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102293903 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 128 (D128G)
Ref Sequence ENSEMBL: ENSMUSP00000122610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036376] [ENSMUST00000073234] [ENSMUST00000107132] [ENSMUST00000107134] [ENSMUST00000137387] [ENSMUST00000156326]
Predicted Effect probably benign
Transcript: ENSMUST00000036376
SMART Domains Protein: ENSMUSP00000047600
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000073234
AA Change: D132G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072967
Gene: ENSMUSG00000059995
AA Change: D132G

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100387
SMART Domains Protein: ENSMUSP00000097956
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
UBQ 212 281 1.75e-9 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107132
AA Change: D132G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102750
Gene: ENSMUSG00000059995
AA Change: D132G

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.1e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 209 246 7.8e-11 PFAM
low complexity region 282 295 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107134
AA Change: D132G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102752
Gene: ENSMUSG00000059995
AA Change: D132G

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137387
AA Change: D128G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122610
Gene: ENSMUSG00000059995
AA Change: D128G

DomainStartEndE-ValueType
Pfam:Sgf11 76 108 2.6e-21 PFAM
low complexity region 131 139 N/A INTRINSIC
low complexity region 146 155 N/A INTRINSIC
Pfam:SCA7 205 242 1.9e-9 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141516
AA Change: D23G
SMART Domains Protein: ENSMUSP00000121917
Gene: ENSMUSG00000059995
AA Change: D23G

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 27 35 N/A INTRINSIC
low complexity region 42 51 N/A INTRINSIC
Pfam:SCA7 113 150 6.7e-11 PFAM
low complexity region 186 199 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145484
Predicted Effect probably benign
Transcript: ENSMUST00000156326
SMART Domains Protein: ENSMUSP00000116327
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mouse embryonic stem cells homozygous for a knock-out allele exhibit strikingly increased H2B monoubiquitination (H2Bub) levels and fail to show loss of global H2Bub following inhibition of transcriptional elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Atxn7l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn7l3 APN 11 102294981 missense probably benign 0.00
IGL01629:Atxn7l3 APN 11 102292494 unclassified probably benign
R0333:Atxn7l3 UTSW 11 102294992 unclassified probably null
R0967:Atxn7l3 UTSW 11 102292435 unclassified probably benign
R0970:Atxn7l3 UTSW 11 102292435 unclassified probably benign
R1073:Atxn7l3 UTSW 11 102292435 unclassified probably benign
R1388:Atxn7l3 UTSW 11 102292435 unclassified probably benign
R1518:Atxn7l3 UTSW 11 102294514 missense probably benign 0.04
R2119:Atxn7l3 UTSW 11 102291981 missense possibly damaging 0.63
R3708:Atxn7l3 UTSW 11 102291879 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTATCTGTCCTTCACCC -3'
(R):5'- GTGCAATTGGTACCGAGGTG -3'

Sequencing Primer
(F):5'- CTTCTTGGCTGGGGGACAAC -3'
(R):5'- CAATTGGTACCGAGGTGTAGTC -3'
Posted On2015-04-06