Incidental Mutation 'R3857:Spty2d1'
ID276211
Institutional Source Beutler Lab
Gene Symbol Spty2d1
Ensembl Gene ENSMUSG00000049516
Gene NameSPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Synonyms5830435K17Rik
MMRRC Submission 040785-MU
Accession Numbers

Genbank: NM_175318; MGI: 2142062

Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R3857 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46990396-47008411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46998296 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 295 (T295I)
Ref Sequence ENSEMBL: ENSMUSP00000059457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061639]
Predicted Effect probably benign
Transcript: ENSMUST00000061639
AA Change: T295I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059457
Gene: ENSMUSG00000049516
AA Change: T295I

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
coiled coil region 45 82 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 199 215 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
internal_repeat_1 283 336 4.09e-5 PROSPERO
low complexity region 338 353 N/A INTRINSIC
internal_repeat_1 366 420 4.09e-5 PROSPERO
low complexity region 434 468 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
SPT2 573 680 1.3e-32 SMART
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 98% (41/42)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Bdkrb2 T C 12: 105,592,439 V313A probably benign Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Dnah8 A G 17: 30,663,422 D656G probably damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Ercc8 A G 13: 108,194,114 E395G possibly damaging Het
F13a1 A G 13: 37,025,694 L99P probably benign Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gm2075 T A 12: 88,012,246 D133E unknown Het
Gse1 T A 8: 120,571,133 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irx1 A T 13: 71,963,458 Y11N possibly damaging Het
Kdm3b T A 18: 34,833,387 I1658N probably benign Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Obscn A G 11: 59,080,969 probably benign Het
Pcna A T 2: 132,249,621 S261T probably benign Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pitpnc1 T C 11: 107,320,805 probably null Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Senp6 A G 9: 80,092,321 T7A possibly damaging Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Spice1 T C 16: 44,355,443 S2P probably damaging Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Togaram1 A G 12: 64,980,859 Q874R possibly damaging Het
Ttn T A 2: 76,908,975 D3740V probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Vmn1r19 A T 6: 57,405,113 Y217F possibly damaging Het
Zfp101 G T 17: 33,382,431 S79* probably null Het
Zfp512 G T 5: 31,472,840 R222L probably damaging Het
Zfyve16 A T 13: 92,494,971 I1372N probably damaging Het
Other mutations in Spty2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Spty2d1 APN 7 46998987 missense probably damaging 1.00
IGL01763:Spty2d1 APN 7 46999848 missense probably damaging 0.99
IGL01988:Spty2d1 APN 7 46997610 missense probably damaging 0.99
IGL02149:Spty2d1 APN 7 47008144 utr 5 prime probably benign
IGL02236:Spty2d1 APN 7 46997612 missense probably benign 0.02
IGL02273:Spty2d1 APN 7 46997573 missense probably damaging 0.97
3-1:Spty2d1 UTSW 7 46998677 missense probably damaging 1.00
R0184:Spty2d1 UTSW 7 46997574 missense possibly damaging 0.94
R0201:Spty2d1 UTSW 7 46997901 nonsense probably null
R1592:Spty2d1 UTSW 7 46998889 missense possibly damaging 0.56
R2116:Spty2d1 UTSW 7 46996185 missense probably damaging 1.00
R2171:Spty2d1 UTSW 7 46994613 missense probably damaging 1.00
R2898:Spty2d1 UTSW 7 46993352 missense unknown
R4080:Spty2d1 UTSW 7 46998581 missense probably damaging 0.99
R4319:Spty2d1 UTSW 7 46998135 missense probably damaging 0.99
R4732:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R4733:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R5317:Spty2d1 UTSW 7 46998301 missense possibly damaging 0.61
R5485:Spty2d1 UTSW 7 46997885 missense possibly damaging 0.76
R5711:Spty2d1 UTSW 7 46998097 missense possibly damaging 0.84
R5761:Spty2d1 UTSW 7 46998284 missense probably damaging 1.00
R6418:Spty2d1 UTSW 7 46998003 missense probably damaging 1.00
R7182:Spty2d1 UTSW 7 46998523 missense probably benign 0.09
R7372:Spty2d1 UTSW 7 46998944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTCTGACACCTGGACTC -3'
(R):5'- ATGGGTACAAAGCCCAGCAG -3'

Sequencing Primer
(F):5'- TGACACCTGGACTCTTAGATTTG -3'
(R):5'- TACAAAGCCCAGCAGAGGTG -3'
Posted On2015-04-06