Incidental Mutation 'R3858:Pmp22'
ID276257
Institutional Source Beutler Lab
Gene Symbol Pmp22
Ensembl Gene ENSMUSG00000018217
Gene Nameperipheral myelin protein 22
SynonymsGas-3
MMRRC Submission 040786-MU
Accession Numbers

Ncbi RefSeq: NM_008885.2; MGI:97631

Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R3858 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location63128982-63159547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63134475 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 45 (S45P)
Ref Sequence ENSEMBL: ENSMUSP00000104342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018361] [ENSMUST00000108700] [ENSMUST00000108701] [ENSMUST00000108702]
Predicted Effect probably benign
Transcript: ENSMUST00000018361
AA Change: S45P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018361
Gene: ENSMUSG00000018217
AA Change: S45P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108700
AA Change: S45P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104340
Gene: ENSMUSG00000018217
AA Change: S45P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108701
AA Change: S45P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104341
Gene: ENSMUSG00000018217
AA Change: S45P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.7e-50 PFAM
Pfam:Claudin_2 55 155 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108702
AA Change: S45P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104342
Gene: ENSMUSG00000018217
AA Change: S45P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140648
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype Strain: 2447704; 3614822
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice with one or two copies of several mutations exhibit tremors, a tendency toward seizures, and partial paralysis associated with demyelination and loss of peripheral axons. Mutants have high juvenile mortality and males are often sterile. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(4) Spontaneous(3) Chemically induced(4)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,813,581 S179T probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
Ccdc82 G A 9: 13,252,079 probably benign Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Cd2ap G A 17: 42,816,572 Q377* probably null Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Efhb A G 17: 53,462,780 L167S possibly damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irs4 T C X: 141,724,063 E379G probably damaging Het
Kcnmb2 T C 3: 32,198,301 V217A probably damaging Het
Megf10 T C 18: 57,275,835 probably benign Het
Mib1 T A 18: 10,798,409 C757S possibly damaging Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Obscn A G 11: 59,080,969 probably benign Het
Olfr103 A T 17: 37,337,226 L2* probably null Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Pirb T C 7: 3,717,663 K279E possibly damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Reck A G 4: 43,930,261 T612A probably benign Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Sis A G 3: 72,928,652 I868T probably damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tle4 G A 19: 14,468,213 T223I probably benign Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem29 T C X: 150,420,361 Q39R probably benign Het
Tor3a T A 1: 156,669,554 L140F probably damaging Het
Vmn2r86 A G 10: 130,455,725 M57T probably benign Het
Zfp512 G T 5: 31,472,840 R222L probably damaging Het
Other mutations in Pmp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Pmp22 APN 11 63158308 missense probably benign
IGL02350:Pmp22 APN 11 63158308 missense probably benign
IGL02357:Pmp22 APN 11 63158308 missense probably benign
IGL02423:Pmp22 APN 11 63158292 missense possibly damaging 0.94
IGL03107:Pmp22 APN 11 63158309 missense probably benign
PIT4431001:Pmp22 UTSW 11 63151241 missense probably benign 0.00
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0453:Pmp22 UTSW 11 63151103 intron probably benign
R0561:Pmp22 UTSW 11 63134424 missense probably damaging 1.00
R5107:Pmp22 UTSW 11 63158411 missense probably damaging 0.99
R6573:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6574:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6575:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTGCTGATCTCACTGG -3'
(R):5'- ACTCCCTCATGAGACAGCTG -3'

Sequencing Primer
(F):5'- TGATCTCACTGGGCAGGAG -3'
(R):5'- GGATATCTGACTCTGTGACACAGTC -3'
Posted On2015-04-06