Incidental Mutation 'R3861:Napepld'
ID276336
Institutional Source Beutler Lab
Gene Symbol Napepld
Ensembl Gene ENSMUSG00000044968
Gene NameN-acyl phosphatidylethanolamine phospholipase D
SynonymsNAPE-PLD
MMRRC Submission 040788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3861 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21662901-21701396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21683289 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 54 (V54E)
Ref Sequence ENSEMBL: ENSMUSP00000110872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060899] [ENSMUST00000115217]
Predicted Effect probably benign
Transcript: ENSMUST00000060899
AA Change: V54E

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054458
Gene: ENSMUSG00000044968
AA Change: V54E

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.5e-14 PFAM
Pfam:Lactamase_B_2 142 344 2.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115217
AA Change: V54E

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110872
Gene: ENSMUSG00000044968
AA Change: V54E

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.3e-13 PFAM
Pfam:Lactamase_B_2 142 344 1.4e-39 PFAM
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NAPEPLD is a phospholipase D type enzyme that catalyzes the release of N-acylethanolamine (NAE) from N-acyl-phosphatidylethanolamine (NAPE) in the second step of the biosynthesis of N-acylethanolamine (Okamoto et al., 2004 [PubMed 14634025]).[supplied by OMIM, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and healthy, but have abnormal brain levels of N-acyl ethanolamines and N-acyl phosphatidylethanolamines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik G A 12: 18,533,410 S157N probably benign Het
A830018L16Rik T C 1: 11,588,554 probably benign Het
Akip1 C T 7: 109,707,406 probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Arhgef10l A G 4: 140,515,487 F1072L possibly damaging Het
Armc1 C T 3: 19,135,032 R186Q probably damaging Het
Atxn2l A T 7: 126,501,951 probably null Het
Cadps2 A G 6: 23,355,861 I849T probably damaging Het
Ccdc28a T A 10: 18,224,995 Q28L probably damaging Het
Cdh4 T A 2: 179,874,097 V356D probably damaging Het
Chd8 T A 14: 52,237,121 Q151L probably benign Het
Chgb T A 2: 132,793,144 H335Q probably damaging Het
Col19a1 G A 1: 24,326,017 P506S probably damaging Het
Col5a2 T C 1: 45,380,237 T1228A probably damaging Het
Cpxm2 A G 7: 132,054,919 V538A probably benign Het
Cramp1l A T 17: 24,997,614 probably benign Het
Cttnbp2 T C 6: 18,423,833 R831G probably benign Het
Cyp4f17 A G 17: 32,528,104 D436G probably damaging Het
Dcaf6 A T 1: 165,429,269 N48K probably damaging Het
Ddx50 C A 10: 62,642,946 V154L possibly damaging Het
Dnah9 T C 11: 66,052,994 probably benign Het
Dnm3 T A 1: 162,311,405 I395L possibly damaging Het
Elp2 C T 18: 24,606,920 R68C probably benign Het
Frg1 A T 8: 41,407,783 probably null Het
Fsip2 G T 2: 82,984,776 D3618Y probably damaging Het
Gabra2 T C 5: 70,973,543 D314G probably damaging Het
Gm906 T C 13: 50,246,851 K480E probably benign Het
Gramd1a A C 7: 31,135,940 D407E possibly damaging Het
Grm5 T A 7: 88,129,994 S881T possibly damaging Het
Ikbkb T A 8: 22,678,836 I216F possibly damaging Het
Kif3a T C 11: 53,597,978 V634A probably benign Het
Ltbp1 A T 17: 75,359,338 Y1342F possibly damaging Het
Mia2 G T 12: 59,109,021 V508L probably benign Het
Mtus2 C T 5: 148,313,413 T155M probably damaging Het
Nlrc4 T C 17: 74,445,621 E589G probably benign Het
Nphp3 G T 9: 104,039,326 probably benign Het
Nr2f1 T A 13: 78,195,675 R10* probably null Het
Nsfl1c C A 2: 151,510,904 probably null Het
Olfr304 A G 7: 86,386,123 V179A possibly damaging Het
Pcdhgc3 A G 18: 37,808,528 T661A probably damaging Het
Pdzrn3 A G 6: 101,172,371 V332A possibly damaging Het
Pkhd1 C T 1: 20,200,927 C3134Y probably damaging Het
Ptprz1 T C 6: 23,036,895 V1131A probably damaging Het
Rccd1 T C 7: 80,320,368 E167G probably benign Het
Ror1 T C 4: 100,407,923 I198T possibly damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scly C T 1: 91,302,851 probably benign Het
Scn4a T C 11: 106,326,124 probably benign Het
Sh3rf2 T C 18: 42,153,319 S594P probably damaging Het
Slc19a1 G A 10: 77,041,975 V115M possibly damaging Het
Slc26a6 A T 9: 108,854,196 probably benign Het
Smg7 C T 1: 152,852,598 R439K probably null Het
Syne2 A G 12: 75,966,479 R2815G probably damaging Het
Tmem55a A G 4: 14,902,506 N169S probably damaging Het
Trim75 G A 8: 64,982,827 R324C probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Zscan29 G C 2: 121,160,731 R859G probably benign Het
Other mutations in Napepld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Napepld APN 5 21683193 missense probably benign 0.11
IGL01659:Napepld APN 5 21675716 missense probably damaging 0.99
IGL01726:Napepld APN 5 21675659 missense possibly damaging 0.93
IGL02083:Napepld APN 5 21676067 missense probably damaging 1.00
IGL02425:Napepld APN 5 21683442 missense probably benign 0.19
R1763:Napepld UTSW 5 21683410 missense probably benign 0.00
R1903:Napepld UTSW 5 21665272 missense probably damaging 0.97
R2166:Napepld UTSW 5 21683232 missense possibly damaging 0.48
R4899:Napepld UTSW 5 21683440 missense probably benign 0.00
R5629:Napepld UTSW 5 21675903 missense probably benign 0.01
R5794:Napepld UTSW 5 21683431 missense possibly damaging 0.93
R6273:Napepld UTSW 5 21665322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACTAAGTAGAGGCCCATACC -3'
(R):5'- TTCAAAGCTTCTCGCCGAGG -3'

Sequencing Primer
(F):5'- GTCATGTATATGTACACAAAGCACAC -3'
(R):5'- TTCTCGCCGAGGGACATG -3'
Posted On2015-04-06