Incidental Mutation 'R3861:Kif3a'
ID276362
Institutional Source Beutler Lab
Gene Symbol Kif3a
Ensembl Gene ENSMUSG00000018395
Gene Namekinesin family member 3A
SynonymsKns3, kinesin-II subunit, N-4 kinesin, Kif3, Kifl
MMRRC Submission 040788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3861 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53567379-53601967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53597978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 634 (V634A)
Ref Sequence ENSEMBL: ENSMUSP00000113848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057330] [ENSMUST00000118353] [ENSMUST00000120613] [ENSMUST00000130037] [ENSMUST00000173744]
Predicted Effect probably benign
Transcript: ENSMUST00000057330
AA Change: V607A

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056197
Gene: ENSMUSG00000018395
AA Change: V607A

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
coiled coil region 416 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118353
AA Change: V634A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113848
Gene: ENSMUSG00000018395
AA Change: V634A

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 418 N/A INTRINSIC
coiled coil region 443 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120613
AA Change: V610A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112782
Gene: ENSMUSG00000018395
AA Change: V610A

DomainStartEndE-ValueType
KISc 12 353 4.6e-189 SMART
coiled coil region 354 383 N/A INTRINSIC
coiled coil region 419 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130037
AA Change: V94A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116509
Gene: ENSMUSG00000018395
AA Change: V94A

DomainStartEndE-ValueType
SCOP:d1cm5a_ 5 88 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173744
AA Change: V603A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133432
Gene: ENSMUSG00000018395
AA Change: V603A

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 406 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
low complexity region 498 526 N/A INTRINSIC
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Nullizygous mutations result in embryonic lethality, failure to synthesize cilia in the embryonic node, randomization of left-right asymmetry and structural abnormalities of the neural tube, pericardium, branchial arches, and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik G A 12: 18,533,410 S157N probably benign Het
A830018L16Rik T C 1: 11,588,554 probably benign Het
Akip1 C T 7: 109,707,406 probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Arhgef10l A G 4: 140,515,487 F1072L possibly damaging Het
Armc1 C T 3: 19,135,032 R186Q probably damaging Het
Atxn2l A T 7: 126,501,951 probably null Het
Cadps2 A G 6: 23,355,861 I849T probably damaging Het
Ccdc28a T A 10: 18,224,995 Q28L probably damaging Het
Cdh4 T A 2: 179,874,097 V356D probably damaging Het
Chd8 T A 14: 52,237,121 Q151L probably benign Het
Chgb T A 2: 132,793,144 H335Q probably damaging Het
Col19a1 G A 1: 24,326,017 P506S probably damaging Het
Col5a2 T C 1: 45,380,237 T1228A probably damaging Het
Cpxm2 A G 7: 132,054,919 V538A probably benign Het
Cramp1l A T 17: 24,997,614 probably benign Het
Cttnbp2 T C 6: 18,423,833 R831G probably benign Het
Cyp4f17 A G 17: 32,528,104 D436G probably damaging Het
Dcaf6 A T 1: 165,429,269 N48K probably damaging Het
Ddx50 C A 10: 62,642,946 V154L possibly damaging Het
Dnah9 T C 11: 66,052,994 probably benign Het
Dnm3 T A 1: 162,311,405 I395L possibly damaging Het
Elp2 C T 18: 24,606,920 R68C probably benign Het
Frg1 A T 8: 41,407,783 probably null Het
Fsip2 G T 2: 82,984,776 D3618Y probably damaging Het
Gabra2 T C 5: 70,973,543 D314G probably damaging Het
Gm906 T C 13: 50,246,851 K480E probably benign Het
Gramd1a A C 7: 31,135,940 D407E possibly damaging Het
Grm5 T A 7: 88,129,994 S881T possibly damaging Het
Ikbkb T A 8: 22,678,836 I216F possibly damaging Het
Ltbp1 A T 17: 75,359,338 Y1342F possibly damaging Het
Mia2 G T 12: 59,109,021 V508L probably benign Het
Mtus2 C T 5: 148,313,413 T155M probably damaging Het
Napepld A T 5: 21,683,289 V54E probably benign Het
Nlrc4 T C 17: 74,445,621 E589G probably benign Het
Nphp3 G T 9: 104,039,326 probably benign Het
Nr2f1 T A 13: 78,195,675 R10* probably null Het
Nsfl1c C A 2: 151,510,904 probably null Het
Olfr304 A G 7: 86,386,123 V179A possibly damaging Het
Pcdhgc3 A G 18: 37,808,528 T661A probably damaging Het
Pdzrn3 A G 6: 101,172,371 V332A possibly damaging Het
Pkhd1 C T 1: 20,200,927 C3134Y probably damaging Het
Ptprz1 T C 6: 23,036,895 V1131A probably damaging Het
Rccd1 T C 7: 80,320,368 E167G probably benign Het
Ror1 T C 4: 100,407,923 I198T possibly damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scly C T 1: 91,302,851 probably benign Het
Scn4a T C 11: 106,326,124 probably benign Het
Sh3rf2 T C 18: 42,153,319 S594P probably damaging Het
Slc19a1 G A 10: 77,041,975 V115M possibly damaging Het
Slc26a6 A T 9: 108,854,196 probably benign Het
Smg7 C T 1: 152,852,598 R439K probably null Het
Syne2 A G 12: 75,966,479 R2815G probably damaging Het
Tmem55a A G 4: 14,902,506 N169S probably damaging Het
Trim75 G A 8: 64,982,827 R324C probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Zscan29 G C 2: 121,160,731 R859G probably benign Het
Other mutations in Kif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Kif3a APN 11 53593523 missense possibly damaging 0.53
IGL01862:Kif3a APN 11 53570541 missense possibly damaging 0.63
IGL02411:Kif3a APN 11 53570698 missense probably damaging 1.00
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0078:Kif3a UTSW 11 53578985 missense probably benign 0.22
R0131:Kif3a UTSW 11 53586916 missense possibly damaging 0.53
R1079:Kif3a UTSW 11 53570581 missense possibly damaging 0.87
R1168:Kif3a UTSW 11 53598312 missense probably damaging 1.00
R1554:Kif3a UTSW 11 53598327 missense probably damaging 0.98
R1817:Kif3a UTSW 11 53598734 missense probably damaging 1.00
R2022:Kif3a UTSW 11 53570581 missense probably damaging 1.00
R2964:Kif3a UTSW 11 53578930 missense probably damaging 1.00
R3928:Kif3a UTSW 11 53570614 missense probably benign 0.02
R4553:Kif3a UTSW 11 53578918 missense possibly damaging 0.93
R5158:Kif3a UTSW 11 53588751 missense probably benign
R5437:Kif3a UTSW 11 53598726 missense probably damaging 0.99
R6621:Kif3a UTSW 11 53579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTACCCATCATGTACGGTAC -3'
(R):5'- AACGCTCTCCACATTGCTG -3'

Sequencing Primer
(F):5'- CGCAGTAGTGATAAATGCAAGGCC -3'
(R):5'- GTGAATCAGAAAGATATTCTATCCGG -3'
Posted On2015-04-06