Incidental Mutation 'R3862:Hint2'
ID276388
Institutional Source Beutler Lab
Gene Symbol Hint2
Ensembl Gene ENSMUSG00000028470
Gene Namehistidine triad nucleotide binding protein 2
Synonyms
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43654227-43656466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43654771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000030192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000030192] [ENSMUST00000056474] [ENSMUST00000084646] [ENSMUST00000107870] [ENSMUST00000107874]
Predicted Effect probably benign
Transcript: ENSMUST00000030191
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000030192
AA Change: V91A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030192
Gene: ENSMUSG00000028470
AA Change: V91A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DcpS_C 53 159 7.1e-25 PFAM
Pfam:HIT 61 158 1.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056474
SMART Domains Protein: ENSMUSP00000057398
Gene: ENSMUSG00000043633

DomainStartEndE-ValueType
low complexity region 81 105 N/A INTRINSIC
internal_repeat_1 119 164 1.12e-19 PROSPERO
internal_repeat_1 165 210 1.12e-19 PROSPERO
low complexity region 267 285 N/A INTRINSIC
Pfam:DUF4475 312 482 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084646
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107870
SMART Domains Protein: ENSMUSP00000103502
Gene: ENSMUSG00000066196

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107874
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably benign
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134082
Predicted Effect probably benign
Transcript: ENSMUST00000149575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155985
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histidine triad proteins, such as HINT2, are nucleotide hydrolases and transferases that act on the alpha-phosphate of ribonucleotides (Brenner, 2002 [PubMed 12119013]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in lipid metabolism, glucose homeostasis, and mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Hint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0326:Hint2 UTSW 4 43654378 missense probably damaging 1.00
R4439:Hint2 UTSW 4 43654919 missense probably damaging 1.00
R4630:Hint2 UTSW 4 43656396 unclassified probably benign
R4988:Hint2 UTSW 4 43654953 missense possibly damaging 0.51
R5643:Hint2 UTSW 4 43656445 unclassified probably benign
X0018:Hint2 UTSW 4 43654811 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACAAGGAGTAAGTGTCCTAG -3'
(R):5'- GAGCATCGCCAACCATCTTC -3'

Sequencing Primer
(F):5'- TAAGTGTCCTAGAAGCTAAAGGG -3'
(R):5'- ATTTTGGACCGGAGTCTCCCAG -3'
Posted On2015-04-06