Incidental Mutation 'R3862:Sgcz'
ID276398
Institutional Source Beutler Lab
Gene Symbol Sgcz
Ensembl Gene ENSMUSG00000039539
Gene Namesarcoglycan zeta
SynonymsC230085N17Rik
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location37522298-38661508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37523411 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 263 (I263V)
Ref Sequence ENSEMBL: ENSMUSP00000113912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118896] [ENSMUST00000135764]
Predicted Effect probably benign
Transcript: ENSMUST00000118896
AA Change: I263V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113912
Gene: ENSMUSG00000039539
AA Change: I263V

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 38 298 4.7e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135764
SMART Domains Protein: ENSMUSP00000117250
Gene: ENSMUSG00000039539

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 38 201 4.4e-54 PFAM
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zeta-sarcoglycan gene measures over 465 kb and localizes to 8p22. This protein is part of the sarcoglycan complex, a group of 6 proteins. The sarcoglycans are all N-glycosylated transmembrane proteins with a short intra-cellular domain, a single transmembrane region and a large extra-cellular domain containing a carboxyl-terminal cluster with several conserved cysteine residues. The sarcoglycan complex is part of the dystrophin-associated glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extra-cellular matrix. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Sgcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Sgcz APN 8 37640015 missense probably damaging 1.00
IGL02593:Sgcz APN 8 37523278 missense probably damaging 0.97
IGL03237:Sgcz APN 8 37563178 missense probably benign 0.01
IGL03238:Sgcz APN 8 37563140 critical splice donor site probably null
R0076:Sgcz UTSW 8 37545442 splice site probably benign
R0276:Sgcz UTSW 8 37952919 missense probably benign 0.18
R2095:Sgcz UTSW 8 37540392 splice site probably benign
R3623:Sgcz UTSW 8 37953047 missense probably damaging 0.96
R3624:Sgcz UTSW 8 37953047 missense probably damaging 0.96
R3863:Sgcz UTSW 8 37523411 missense probably benign
R3953:Sgcz UTSW 8 37526192 splice site probably benign
R3956:Sgcz UTSW 8 37526192 splice site probably benign
R5120:Sgcz UTSW 8 37526266 missense probably benign 0.30
R5121:Sgcz UTSW 8 37539667 missense probably damaging 1.00
R5431:Sgcz UTSW 8 37639984 missense probably damaging 0.98
R5913:Sgcz UTSW 8 37526271 missense possibly damaging 0.75
R6921:Sgcz UTSW 8 37526289 missense probably damaging 1.00
R7151:Sgcz UTSW 8 37539679 missense possibly damaging 0.67
R7412:Sgcz UTSW 8 37523411 missense probably benign
R7507:Sgcz UTSW 8 37953046 missense probably benign 0.05
R7554:Sgcz UTSW 8 37563272 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGAACAAAAGGCTATTCTGGTGTG -3'
(R):5'- TTTAAGACAGCAGCAGAGCCC -3'

Sequencing Primer
(F):5'- TGAGGAGAAATCAGTCGCTTCAGTTC -3'
(R):5'- CAGTGCACAGGCTTGTAATC -3'
Posted On2015-04-06