Incidental Mutation 'R3862:Olfr968'
ID276402
Institutional Source Beutler Lab
Gene Symbol Olfr968
Ensembl Gene ENSMUSG00000095903
Gene Nameolfactory receptor 968
SynonymsGA_x6K02T2PVTD-33470347-33469403, MOR171-15
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39768776-39783253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39772624 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 59 (M59L)
Ref Sequence ENSEMBL: ENSMUSP00000148969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075928] [ENSMUST00000216458]
Predicted Effect probably benign
Transcript: ENSMUST00000075928
AA Change: M59L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096472
Gene: ENSMUSG00000095903
AA Change: M59L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-51 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216458
AA Change: M59L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Olfr968
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Olfr968 APN 9 39772111 missense possibly damaging 0.78
IGL01109:Olfr968 APN 9 39771997 missense probably benign 0.06
IGL01809:Olfr968 APN 9 39772694 nonsense probably null
IGL02517:Olfr968 APN 9 39772504 missense probably damaging 0.98
IGL02708:Olfr968 APN 9 39771918 missense probably damaging 1.00
IGL03061:Olfr968 APN 9 39772162 missense probably benign 0.41
K3955:Olfr968 UTSW 9 39772173 missense probably benign 0.00
R1786:Olfr968 UTSW 9 39772495 missense probably benign 0.00
R1897:Olfr968 UTSW 9 39772065 missense probably damaging 0.99
R2424:Olfr968 UTSW 9 39772297 missense probably benign 0.39
R3016:Olfr968 UTSW 9 39772683 missense probably benign 0.41
R5987:Olfr968 UTSW 9 39772540 missense probably benign 0.00
R5995:Olfr968 UTSW 9 39772692 missense probably benign 0.03
R6184:Olfr968 UTSW 9 39772620 missense probably damaging 1.00
R6297:Olfr968 UTSW 9 39772226 missense possibly damaging 0.45
R7402:Olfr968 UTSW 9 39771964 missense probably benign 0.45
X0028:Olfr968 UTSW 9 39772794 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGGCTTACAAATGGCAAC -3'
(R):5'- TCCCAGAAGAAAATGTTCCAAGG -3'

Sequencing Primer
(F):5'- TAGCGGTCATATGCCATTACAGC -3'
(R):5'- GAAATCTTTCCGGAGTAACTGAGTTC -3'
Posted On2015-04-06