Incidental Mutation 'R3862:Hapln1'
ID276412
Institutional Source Beutler Lab
Gene Symbol Hapln1
Ensembl Gene ENSMUSG00000021613
Gene Namehyaluronan and proteoglycan link protein 1
Synonymslink protein, LP-1, CLP, cartilage linking protein 1, Crtl1l, Crtl1
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3862 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location89539796-89611652 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 89605299 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 195 (Q195*)
Ref Sequence ENSEMBL: ENSMUSP00000022108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022108]
Predicted Effect probably null
Transcript: ENSMUST00000022108
AA Change: Q195*
SMART Domains Protein: ENSMUSP00000022108
Gene: ENSMUSG00000021613
AA Change: Q195*

DomainStartEndE-ValueType
IGv 58 143 3.48e-12 SMART
LINK 159 256 7.26e-61 SMART
LINK 260 353 8.35e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225678
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in cartilage development and delayed bone formation with short limbs and craniofacial anomalies. Mutants usually die as neonates due to respiratory failure, but some survive and develop dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Zfand4 A T 6: 116,293,815 probably benign Het
Other mutations in Hapln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Hapln1 APN 13 89608142 missense probably benign 0.00
IGL00494:Hapln1 APN 13 89605471 missense probably benign 0.04
IGL01865:Hapln1 APN 13 89601665 missense probably damaging 1.00
IGL02706:Hapln1 APN 13 89605459 missense possibly damaging 0.86
IGL02990:Hapln1 APN 13 89601606 missense probably benign 0.03
R0033:Hapln1 UTSW 13 89601813 missense probably benign 0.20
R0058:Hapln1 UTSW 13 89607878 missense probably benign 0.17
R0058:Hapln1 UTSW 13 89607878 missense probably benign 0.17
R0127:Hapln1 UTSW 13 89607869 missense probably benign 0.22
R0519:Hapln1 UTSW 13 89584716 start gained probably benign
R3982:Hapln1 UTSW 13 89605441 missense probably benign
R4717:Hapln1 UTSW 13 89605460 missense probably benign 0.11
R4861:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4861:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4862:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4899:Hapln1 UTSW 13 89601650 missense possibly damaging 0.90
R5402:Hapln1 UTSW 13 89605411 missense probably benign 0.07
R5629:Hapln1 UTSW 13 89601515 missense probably damaging 0.98
R6019:Hapln1 UTSW 13 89608100 missense probably benign 0.45
Z1088:Hapln1 UTSW 13 89601498 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTACCTGTAAGTGGACCTG -3'
(R):5'- TTGCCCTGGATAGAGGTGAAGG -3'

Sequencing Primer
(F):5'- GCCCAGGGCTCTATCACTAATG -3'
(R):5'- CAGCTGCTGTCTTACCGTTGAAG -3'
Posted On2015-04-06