Incidental Mutation 'R3864:Naa25'
ID276455
Institutional Source Beutler Lab
Gene Symbol Naa25
Ensembl Gene ENSMUSG00000042719
Gene NameN(alpha)-acetyltransferase 25, NatB auxiliary subunit
SynonymsC330023M02Rik, 4833422K13Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3864 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121397936-121444378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121409197 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 132 (M132K)
Ref Sequence ENSEMBL: ENSMUSP00000038977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042163] [ENSMUST00000151458] [ENSMUST00000173895]
Predicted Effect probably damaging
Transcript: ENSMUST00000042163
AA Change: M132K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038977
Gene: ENSMUSG00000042719
AA Change: M132K

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:NatB_MDM20 263 658 1.6e-121 PFAM
low complexity region 672 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
low complexity region 721 734 N/A INTRINSIC
low complexity region 915 935 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131598
Predicted Effect probably benign
Transcript: ENSMUST00000151458
SMART Domains Protein: ENSMUSP00000120970
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
SCOP:d1a17__ 21 94 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198012
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the auxiliary subunit of the heteromeric N-terminal acetyltransferase B complex. This complex acetylates methionine residues that are followed by acidic or asparagine residues.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G A 11: 116,596,816 G114S probably damaging Het
Abcc4 G A 14: 118,616,415 A360V probably benign Het
BC067074 A G 13: 113,322,951 T1339A possibly damaging Het
Catsper1 T C 19: 5,336,176 S146P possibly damaging Het
Ccny A T 18: 9,449,604 L23Q probably damaging Het
Chml A T 1: 175,688,244 V37D probably damaging Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Dhx40 A T 11: 86,789,245 V422E possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Gm10309 A C 17: 86,498,993 probably benign Het
Greb1 G A 12: 16,702,420 R974W probably damaging Het
Grhl1 T C 12: 24,615,930 *619Q probably null Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Lats1 T C 10: 7,705,746 V765A probably damaging Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Mfn1 A G 3: 32,563,092 D41G possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Scfd2 T G 5: 74,397,720 K499Q possibly damaging Het
Tbc1d2 T C 4: 46,620,484 D442G probably benign Het
Wwc1 T A 11: 35,910,316 D98V probably damaging Het
Zfp426 G A 9: 20,470,086 T521I possibly damaging Het
Other mutations in Naa25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Naa25 APN 5 121439865 missense probably damaging 1.00
IGL02142:Naa25 APN 5 121426762 missense possibly damaging 0.52
IGL02541:Naa25 APN 5 121424531 missense possibly damaging 0.92
IGL02747:Naa25 APN 5 121414605 splice site probably benign
IGL03074:Naa25 APN 5 121408337 critical splice donor site probably null
IGL03119:Naa25 APN 5 121434978 missense probably null 1.00
IGL03218:Naa25 APN 5 121426070 missense probably damaging 1.00
R0003:Naa25 UTSW 5 121407184 intron probably benign
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0399:Naa25 UTSW 5 121435490 missense probably benign 0.00
R0973:Naa25 UTSW 5 121438716 splice site probably benign
R1418:Naa25 UTSW 5 121423734 missense probably damaging 1.00
R1582:Naa25 UTSW 5 121434829 missense probably benign
R1793:Naa25 UTSW 5 121417415 missense possibly damaging 0.82
R1793:Naa25 UTSW 5 121420593 missense probably damaging 1.00
R1863:Naa25 UTSW 5 121435548 missense probably benign 0.00
R3160:Naa25 UTSW 5 121435072 splice site probably null
R3162:Naa25 UTSW 5 121435072 splice site probably null
R3721:Naa25 UTSW 5 121431556 missense probably benign
R4852:Naa25 UTSW 5 121430692 missense probably damaging 1.00
R5077:Naa25 UTSW 5 121424576 missense probably benign 0.02
R5602:Naa25 UTSW 5 121420495 missense probably benign 0.30
R5855:Naa25 UTSW 5 121423692 missense possibly damaging 0.94
R6464:Naa25 UTSW 5 121417961 missense probably damaging 1.00
R6734:Naa25 UTSW 5 121438825 missense possibly damaging 0.65
R6750:Naa25 UTSW 5 121408309 missense probably damaging 1.00
R6767:Naa25 UTSW 5 121439865 missense probably damaging 1.00
R6856:Naa25 UTSW 5 121438804 missense probably damaging 1.00
R7145:Naa25 UTSW 5 121417489 critical splice donor site probably null
X0004:Naa25 UTSW 5 121413081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCAGTAGGACTTTTCTC -3'
(R):5'- AATGTCACCCAGGAGAGCAATC -3'

Sequencing Primer
(F):5'- CTTTTCTCAGGGAAGCAGAACTG -3'
(R):5'- TCTGGAGCTGACACTAAAGC -3'
Posted On2015-04-06