Incidental Mutation 'R3870:Tas1r3'
ID276494
Institutional Source Beutler Lab
Gene Symbol Tas1r3
Ensembl Gene ENSMUSG00000029072
Gene Nametaste receptor, type 1, member 3
SynonymsT1r3
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155859268-155863362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155861353 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 529 (C529S)
Ref Sequence ENSEMBL: ENSMUSP00000030949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030949
AA Change: C529S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: C529S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Tas1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tas1r3 APN 4 155861327 missense probably benign 0.43
IGL01587:Tas1r3 APN 4 155861359 missense probably damaging 0.99
IGL02314:Tas1r3 APN 4 155860662 missense probably damaging 1.00
IGL02747:Tas1r3 APN 4 155860460 missense possibly damaging 0.92
IGL02999:Tas1r3 APN 4 155862359 missense probably damaging 0.97
IGL03026:Tas1r3 APN 4 155861843 unclassified probably benign
IGL03407:Tas1r3 APN 4 155861982 unclassified probably null
R0122:Tas1r3 UTSW 4 155860833 missense probably benign
R0827:Tas1r3 UTSW 4 155860869 missense probably benign 0.02
R1700:Tas1r3 UTSW 4 155861570 missense probably benign
R1803:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1804:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1883:Tas1r3 UTSW 4 155862153 missense probably damaging 1.00
R1998:Tas1r3 UTSW 4 155862920 missense probably damaging 1.00
R2061:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2104:Tas1r3 UTSW 4 155862131 missense probably benign 0.26
R2127:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2129:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2237:Tas1r3 UTSW 4 155862218 missense possibly damaging 0.58
R2316:Tas1r3 UTSW 4 155863315 missense probably benign
R2847:Tas1r3 UTSW 4 155860202 missense probably benign 0.08
R3619:Tas1r3 UTSW 4 155860953 missense probably damaging 0.99
R4194:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4195:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4420:Tas1r3 UTSW 4 155862332 missense probably damaging 0.99
R5577:Tas1r3 UTSW 4 155862065 missense probably benign 0.36
R6734:Tas1r3 UTSW 4 155860800 missense probably damaging 1.00
R7006:Tas1r3 UTSW 4 155862904 missense possibly damaging 0.93
R7231:Tas1r3 UTSW 4 155862826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGTAATGTGGGGTCTGCTG -3'
(R):5'- TAAAATGTACTGGCCAGGCAAC -3'

Sequencing Primer
(F):5'- AATGTGGGGTCTGCTGATGGG -3'
(R):5'- CCAGGCAACCAGGTAAGGAC -3'
Posted On2015-04-06