Incidental Mutation 'R3870:Lmtk2'
ID276500
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Namelemur tyrosine kinase 2
SynonymsAATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK
MMRRC Submission 040789-MU
Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144100436-144188204 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 144166427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
Predicted Effect probably benign
Transcript: ENSMUST00000041804
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144134155 missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144174694 missense probably benign
IGL00848:Lmtk2 APN 5 144176398 missense probably benign
IGL01450:Lmtk2 APN 5 144174702 missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144175935 nonsense probably null
IGL01967:Lmtk2 APN 5 144182779 missense probably benign
IGL01998:Lmtk2 APN 5 144176065 missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144175951 missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144156936 missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144148348 missense probably damaging 1.00
A4554:Lmtk2 UTSW 5 144166317 missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144174991 missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144174589 missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144173862 missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144174175 missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144175110 missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144147609 missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144176106 missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144173626 missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144173911 missense probably benign 0.05
R4011:Lmtk2 UTSW 5 144175879 missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144183226 missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144147664 missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144174781 missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144174934 missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144176447 missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144174838 missense probably benign
R6083:Lmtk2 UTSW 5 144182756 missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144175342 missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144174586 missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144173806 missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144174685 missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144174919 missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144148357 missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144173797 missense probably damaging 1.00
X0024:Lmtk2 UTSW 5 144174250 missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144182851 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCTCCCCTCACATGGAATTC -3'
(R):5'- TAACAGCCCAAACCTCTCAGTTTTC -3'

Sequencing Primer
(F):5'- ATGGAATTCCCCTGAACACTGTG -3'
(R):5'- AAGCACTTACTGTATTCCAGGCCG -3'
Posted On2015-04-06