Incidental Mutation 'R3870:Nipa2'
ID276504
Institutional Source Beutler Lab
Gene Symbol Nipa2
Ensembl Gene ENSMUSG00000030452
Gene Namenon imprinted in Prader-Willi/Angelman syndrome 2 homolog (human)
Synonyms
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55931287-55962476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55932942 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 352 (R352G)
Ref Sequence ENSEMBL: ENSMUSP00000114020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000032635] [ENSMUST00000085255] [ENSMUST00000117812] [ENSMUST00000119041] [ENSMUST00000119201] [ENSMUST00000126604] [ENSMUST00000152649] [ENSMUST00000163845]
Predicted Effect probably benign
Transcript: ENSMUST00000032629
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032635
AA Change: R352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032635
Gene: ENSMUSG00000030452
AA Change: R352G

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085255
SMART Domains Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1222 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117812
AA Change: R352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113727
Gene: ENSMUSG00000030452
AA Change: R352G

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 8 302 1.4e-151 PFAM
Pfam:EamA 47 128 4.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119041
AA Change: R352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112394
Gene: ENSMUSG00000030452
AA Change: R352G

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119201
AA Change: R352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114020
Gene: ENSMUSG00000030452
AA Change: R352G

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126604
SMART Domains Protein: ENSMUSP00000116219
Gene: ENSMUSG00000030452

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 130 1.2e-66 PFAM
Pfam:EmrE 14 130 1.8e-11 PFAM
Pfam:EamA 50 128 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147950
Predicted Effect probably benign
Transcript: ENSMUST00000152649
SMART Domains Protein: ENSMUSP00000120798
Gene: ENSMUSG00000030452

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 127 1.9e-53 PFAM
Pfam:EamA 10 109 1.8e-9 PFAM
Pfam:EmrE 18 116 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163845
SMART Domains Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1224 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206417
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Nipa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Nipa2 APN 7 55933445 missense probably damaging 1.00
IGL01965:Nipa2 APN 7 55944623 start gained probably benign
IGL02373:Nipa2 APN 7 55933128 missense probably benign 0.01
IGL02812:Nipa2 APN 7 55943018 missense probably damaging 1.00
IGL03079:Nipa2 APN 7 55933457 missense probably damaging 1.00
IGL03188:Nipa2 APN 7 55932932 missense probably benign
R1327:Nipa2 UTSW 7 55944508 missense possibly damaging 0.81
R2356:Nipa2 UTSW 7 55932966 missense probably benign 0.00
R3758:Nipa2 UTSW 7 55935941 missense probably damaging 1.00
R4684:Nipa2 UTSW 7 55935826 missense probably benign
R4775:Nipa2 UTSW 7 55935863 missense probably benign 0.19
R5285:Nipa2 UTSW 7 55933012 nonsense probably null
R6453:Nipa2 UTSW 7 55935821 missense probably damaging 0.98
R6880:Nipa2 UTSW 7 55933251 missense probably damaging 0.99
R7459:Nipa2 UTSW 7 55933341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTGAGGTCATATTAGTGAGC -3'
(R):5'- TTGAGTGGCTTCTTCACAATCATTG -3'

Sequencing Primer
(F):5'- GTGAGCTACCATTGTTTAACTAT -3'
(R):5'- GGGGATATTTTTGTTGCATGCC -3'
Posted On2015-04-06