Incidental Mutation 'R3870:Snx33'
ID276516
Institutional Source Beutler Lab
Gene Symbol Snx33
Ensembl Gene ENSMUSG00000032733
Gene Namesorting nexin 33
SynonymsSh3px3, E130307J07Rik
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56917193-56928371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56926740 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 15 (N15S)
Ref Sequence ENSEMBL: ENSMUSP00000060225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050916]
Predicted Effect probably benign
Transcript: ENSMUST00000050916
AA Change: N15S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: N15S

DomainStartEndE-ValueType
SH3 3 60 3.2e-15 SMART
low complexity region 111 122 N/A INTRINSIC
PX 227 336 6.69e-18 SMART
Pfam:BAR_3_WASP_bdg 337 572 1.1e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213112
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Snx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Snx33 APN 9 56926578 missense probably benign
IGL02646:Snx33 APN 9 56926759 missense probably damaging 1.00
IGL03028:Snx33 APN 9 56926451 missense probably benign
R0206:Snx33 UTSW 9 56926224 missense probably damaging 1.00
R0755:Snx33 UTSW 9 56925457 missense possibly damaging 0.84
R1218:Snx33 UTSW 9 56925985 missense probably damaging 1.00
R1523:Snx33 UTSW 9 56926182 missense possibly damaging 0.47
R1627:Snx33 UTSW 9 56925957 missense probably damaging 1.00
R1758:Snx33 UTSW 9 56926698 missense probably benign 0.29
R1856:Snx33 UTSW 9 56926011 missense possibly damaging 0.85
R1885:Snx33 UTSW 9 56925837 missense probably benign 0.42
R2113:Snx33 UTSW 9 56926440 missense probably benign 0.28
R2422:Snx33 UTSW 9 56918538 missense probably benign 0.03
R3789:Snx33 UTSW 9 56918560 missense probably benign 0.00
R3871:Snx33 UTSW 9 56926740 missense probably benign 0.05
R4734:Snx33 UTSW 9 56925901 missense possibly damaging 0.84
R4884:Snx33 UTSW 9 56926180 missense probably damaging 0.99
R5069:Snx33 UTSW 9 56926191 missense probably damaging 0.97
R5555:Snx33 UTSW 9 56925397 missense probably benign
R6153:Snx33 UTSW 9 56926699 missense possibly damaging 0.74
R7178:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7179:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7315:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7414:Snx33 UTSW 9 56925867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATAGTCCACATGGTTGGTG -3'
(R):5'- TTCTTTGACCAAAAGGCAGC -3'

Sequencing Primer
(F):5'- CACATGGTTGGTGCTGATGCC -3'
(R):5'- GGCAAGGCATTTTCCTTC -3'
Posted On2015-04-06