Incidental Mutation 'R3870:Ryk'
ID276521
Institutional Source Beutler Lab
Gene Symbol Ryk
Ensembl Gene ENSMUSG00000032547
Gene Namereceptor-like tyrosine kinase
SynonymsVik, ERK-3
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3870 (G1)
Quality Score183
Status Validated
Chromosome9
Chromosomal Location102834917-102908305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102891228 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 359 (E359G)
Ref Sequence ENSEMBL: ENSMUSP00000135858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035142] [ENSMUST00000175883] [ENSMUST00000176198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035142
AA Change: E356G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035142
Gene: ENSMUSG00000032547
AA Change: E356G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 314 580 1.76e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175883
AA Change: E359G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135858
Gene: ENSMUSG00000032547
AA Change: E359G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
WIF 47 180 9.24e-82 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 247 266 N/A INTRINSIC
TyrKc 317 583 1.76e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176198
SMART Domains Protein: ENSMUSP00000135396
Gene: ENSMUSG00000032547

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an atypical member of the family of growth factor receptor protein tyrosine kinases, differing from other members at a number of conserved residues in the activation and nucleotide binding domains. This gene product belongs to a subfamily whose members do not appear to be regulated by phosphorylation in the activation segment. It has been suggested that mediation of biological activity by recruitment of a signaling-competent auxiliary protein may occur through an as yet uncharacterized mechanism. The encoded protein has a leucine-rich extracellular domain with a WIF-type Wnt binding region, a single transmembrane domain, and an intracellular tyrosine kinase domain. This protein is involved in stimulating Wnt signaling pathways such as the regulation of axon pathfinding. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice have a distinctive craniofacial appearance, shortened limbs and postnatal mortality due to feeding and respiratory complications associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Ryk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ryk APN 9 102897266 missense probably benign 0.38
R1168:Ryk UTSW 9 102898475 missense probably damaging 1.00
R1827:Ryk UTSW 9 102888507 missense probably benign 0.03
R2030:Ryk UTSW 9 102881656 missense possibly damaging 0.90
R2084:Ryk UTSW 9 102875772 missense probably damaging 1.00
R4675:Ryk UTSW 9 102891216 missense possibly damaging 0.94
R5195:Ryk UTSW 9 102867613 missense probably benign 0.00
R5338:Ryk UTSW 9 102897317 nonsense probably null
R5469:Ryk UTSW 9 102906954 missense possibly damaging 0.76
R6668:Ryk UTSW 9 102869276 missense possibly damaging 0.75
R7340:Ryk UTSW 9 102898538 missense probably damaging 0.99
X0020:Ryk UTSW 9 102881743 missense probably damaging 0.96
X0066:Ryk UTSW 9 102869410 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGTGAAAGCTGCCGTCTC -3'
(R):5'- GACAGGTACATGATACGTAGACTC -3'

Sequencing Primer
(F):5'- TCTCCAGCCAGGGTCTGTC -3'
(R):5'- GCTTTCAATGAGCACGCATTTAC -3'
Posted On2015-04-06