Incidental Mutation 'R3870:Pgbd1'
ID276528
Institutional Source Beutler Lab
Gene Symbol Pgbd1
Ensembl Gene ENSMUSG00000055313
Gene NamepiggyBac transposable element derived 1
Synonyms4921509E05Rik
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21421275-21441058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21434370 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 39 (R39H)
Ref Sequence ENSEMBL: ENSMUSP00000120175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099719] [ENSMUST00000122872] [ENSMUST00000145494] [ENSMUST00000148071] [ENSMUST00000151743]
Predicted Effect probably benign
Transcript: ENSMUST00000099719
AA Change: R39H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097307
Gene: ENSMUSG00000055313
AA Change: R39H

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122872
AA Change: R39H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313
AA Change: R39H

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145494
AA Change: R39H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118503
Gene: ENSMUSG00000055313
AA Change: R39H

DomainStartEndE-ValueType
Blast:SCAN 1 65 8e-15 BLAST
low complexity region 192 204 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148071
AA Change: R39H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313
AA Change: R39H

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151743
AA Change: R39H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313
AA Change: R39H

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. This gene product is specifically expressed in the brain, however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Pgbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Pgbd1 APN 13 21423253 nonsense probably null
IGL03136:Pgbd1 APN 13 21433439 missense possibly damaging 0.46
R0206:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0208:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0420:Pgbd1 UTSW 13 21423166 missense possibly damaging 0.50
R0547:Pgbd1 UTSW 13 21423518 missense probably damaging 1.00
R0589:Pgbd1 UTSW 13 21434430 missense possibly damaging 0.92
R0854:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R0891:Pgbd1 UTSW 13 21422800 missense probably damaging 0.97
R1589:Pgbd1 UTSW 13 21423292 missense probably damaging 0.97
R1700:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R1815:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R2139:Pgbd1 UTSW 13 21423020 missense probably damaging 1.00
R3776:Pgbd1 UTSW 13 21428373 missense probably benign 0.00
R3871:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R4580:Pgbd1 UTSW 13 21428329 missense probably benign 0.07
R5644:Pgbd1 UTSW 13 21423152 missense probably damaging 0.99
R6480:Pgbd1 UTSW 13 21423476 missense probably benign 0.13
R6978:Pgbd1 UTSW 13 21423262 missense probably damaging 1.00
R7084:Pgbd1 UTSW 13 21423130 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TCGGCACAATGACTTCACAG -3'
(R):5'- CCTTGTGACAGTGAAGGTGG -3'

Sequencing Primer
(F):5'- GGCACATCATGGAACCAGTGTTAC -3'
(R):5'- CTTGTGACAGTGAAGGTGGAAGATC -3'
Posted On2015-04-06