Incidental Mutation 'R3870:Glud1'
ID276532
Institutional Source Beutler Lab
Gene Symbol Glud1
Ensembl Gene ENSMUSG00000021794
Gene Nameglutamate dehydrogenase 1
SynonymsGdh-X, Glud
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34310727-34345265 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 34325580 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022322]
Predicted Effect probably benign
Transcript: ENSMUST00000022322
SMART Domains Protein: ENSMUSP00000022322
Gene: ENSMUSG00000021794

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
Pfam:ELFV_dehydrog_N 112 242 1.3e-63 PFAM
ELFV_dehydrog 265 554 1.33e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162912
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glutamate dehydrogenase, which is a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid-induced insulin secretion. It is allosterically activated by ADP and inhibited by GTP and ATP. Activating mutations in this gene are a common cause of congenital hyperinsulinism. Alternative splicing of this gene results in multiple transcript variants. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Related pseudogenes have been identified on chromosomes 10, 18 and X. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a conditionally allele activated in beta cells exhibit reduced glucose-stimulated insulin secretion and disorganization of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Glud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Glud1 APN 14 34336130 missense probably benign
IGL00973:Glud1 APN 14 34319942 missense probably damaging 1.00
IGL01896:Glud1 APN 14 34319905 missense probably benign 0.00
IGL02442:Glud1 APN 14 34335438 nonsense probably null
IGL03242:Glud1 APN 14 34334280 missense probably benign 0.00
PIT4283001:Glud1 UTSW 14 34336172 missense probably damaging 0.97
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0845:Glud1 UTSW 14 34329394 unclassified probably benign
R1765:Glud1 UTSW 14 34325584 splice site probably benign
R4645:Glud1 UTSW 14 34311106 missense probably damaging 1.00
R4773:Glud1 UTSW 14 34321825 critical splice donor site probably null
R4883:Glud1 UTSW 14 34335390 missense possibly damaging 0.56
R5912:Glud1 UTSW 14 34311343 critical splice donor site probably null
R6356:Glud1 UTSW 14 34311216 missense probably benign
R6443:Glud1 UTSW 14 34339927 missense probably benign 0.02
X0013:Glud1 UTSW 14 34338823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGAGTGTCTTTCCAGC -3'
(R):5'- CTGCAGCGAGAACCTGAACTTG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- GCGAGAACCTGAACTTGTTAAAAAC -3'
Posted On2015-04-06