Incidental Mutation 'R3870:Exoc5'
ID276534
Institutional Source Beutler Lab
Gene Symbol Exoc5
Ensembl Gene ENSMUSG00000061244
Gene Nameexocyst complex component 5
SynonymsSec10l1, SEC10, PRO1912
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49004090-49066653 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 49019396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161504] [ENSMUST00000162175]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160833
Predicted Effect probably benign
Transcript: ENSMUST00000161504
SMART Domains Protein: ENSMUSP00000124012
Gene: ENSMUSG00000061244

DomainStartEndE-ValueType
Pfam:Sec10 43 175 9.5e-24 PFAM
Pfam:Sec10 175 642 1.1e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162175
SMART Domains Protein: ENSMUSP00000125434
Gene: ENSMUSG00000061244

DomainStartEndE-ValueType
Pfam:Sec10 89 707 6.6e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226647
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells die prior to E8.5. Mice homozygous for a conditional allele activated in kidney cells exhibit ureteropelvic junction obstructions leading to neontal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Exoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Exoc5 APN 14 49037755 missense probably damaging 1.00
IGL01473:Exoc5 APN 14 49014294 missense possibly damaging 0.83
IGL01599:Exoc5 APN 14 49034964 missense probably benign 0.00
IGL01702:Exoc5 APN 14 49015615 nonsense probably null
IGL02173:Exoc5 APN 14 49034801 splice site probably benign
IGL02211:Exoc5 APN 14 49014210 missense probably damaging 1.00
IGL02874:Exoc5 APN 14 49051446 missense probably benign 0.02
IGL02968:Exoc5 APN 14 49033269 critical splice donor site probably null
IGL03167:Exoc5 APN 14 49051345 missense probably damaging 1.00
IGL03207:Exoc5 APN 14 49033375 missense probably benign
PIT4260001:Exoc5 UTSW 14 49048765 missense probably benign 0.01
R0139:Exoc5 UTSW 14 49036036 missense probably damaging 1.00
R0594:Exoc5 UTSW 14 49036087 splice site probably benign
R0945:Exoc5 UTSW 14 49039342 splice site probably benign
R1968:Exoc5 UTSW 14 49034890 missense probably benign 0.27
R2082:Exoc5 UTSW 14 49015587 missense probably benign 0.07
R2186:Exoc5 UTSW 14 49015479 missense probably benign 0.08
R2356:Exoc5 UTSW 14 49016281 missense probably benign 0.00
R3419:Exoc5 UTSW 14 49023278 missense probably damaging 1.00
R3743:Exoc5 UTSW 14 49014349 missense probably benign 0.00
R3743:Exoc5 UTSW 14 49033407 nonsense probably null
R4273:Exoc5 UTSW 14 49015480 nonsense probably null
R4794:Exoc5 UTSW 14 49048900 critical splice acceptor site probably null
R4853:Exoc5 UTSW 14 49052369 small deletion probably benign
R4864:Exoc5 UTSW 14 49052382 missense probably benign 0.00
R4883:Exoc5 UTSW 14 49052364 missense probably damaging 1.00
R5098:Exoc5 UTSW 14 49048847 missense possibly damaging 0.90
R5965:Exoc5 UTSW 14 49034931 missense probably damaging 1.00
R6036:Exoc5 UTSW 14 49014322 missense possibly damaging 0.82
R6036:Exoc5 UTSW 14 49014322 missense possibly damaging 0.82
R6820:Exoc5 UTSW 14 49048930 intron probably null
Predicted Primers PCR Primer
(F):5'- GAAGGCCCTTTCCACATTAGATTTC -3'
(R):5'- GCCCAGGCACGTTGTTAATTG -3'

Sequencing Primer
(F):5'- CCACATTAGATTTCAGATTTTGGTTC -3'
(R):5'- ATCATGAAGATGATTAACTTTGGGG -3'
Posted On2015-04-06