Incidental Mutation 'R3870:Usp14'
ID276545
Institutional Source Beutler Lab
Gene Symbol Usp14
Ensembl Gene ENSMUSG00000047879
Gene Nameubiquitin specific peptidase 14
Synonyms2610005K12Rik, ataxia, NMF375, nmf375, dUB-type TGT, ax, 2610037B11Rik
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location9995432-10045119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10002370 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 314 (S314P)
Ref Sequence ENSEMBL: ENSMUSP00000089728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092096] [ENSMUST00000116669]
PDB Structure
Solution Structure of the N-terminal Ubiquitin-like Domain of Mouse Ubiquitin Specific Protease 14 (USP14) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092096
AA Change: S314P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089728
Gene: ENSMUSG00000047879
AA Change: S314P

DomainStartEndE-ValueType
UBQ 4 74 3.61e-11 SMART
Pfam:UCH 104 479 9e-57 PFAM
Pfam:UCH_1 105 456 3.2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116669
AA Change: S279P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112368
Gene: ENSMUSG00000047879
AA Change: S279P

DomainStartEndE-ValueType
UBQ 4 73 2.63e-4 SMART
low complexity region 217 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154088
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic mutation develop severe tremors by 3 weeks of age, followed by hindlimb paralysis and premature death. An underdeveloped corpus callosum, hippocampus, dentate gyrus and forebrain structures, and notable defects in synaptic transmission in both the CNS and PNS are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Scg3 T C 9: 75,675,499 probably benign Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Usp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02671:Usp14 APN 18 9997196 missense probably damaging 0.99
IGL02756:Usp14 APN 18 10001769 critical splice donor site probably null
PIT4354001:Usp14 UTSW 18 9996189 missense probably damaging 1.00
R1238:Usp14 UTSW 18 9997763 missense probably benign
R1343:Usp14 UTSW 18 10016623 missense probably benign 0.03
R1365:Usp14 UTSW 18 10000490 splice site probably null
R1495:Usp14 UTSW 18 10004994 missense probably benign 0.01
R1817:Usp14 UTSW 18 10024673 missense probably damaging 1.00
R2021:Usp14 UTSW 18 10024632 missense probably damaging 0.99
R2190:Usp14 UTSW 18 10007835 missense probably damaging 1.00
R3836:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3837:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3838:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3839:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3871:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R5388:Usp14 UTSW 18 10018023 missense probably damaging 1.00
R5767:Usp14 UTSW 18 10009935 intron probably benign
R5871:Usp14 UTSW 18 9996234 missense probably benign 0.27
R5898:Usp14 UTSW 18 10022819 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGTCACTGCTCCAACCAGC -3'
(R):5'- AGAGCAACATTGTATTCAGAGCCTTTT -3'

Sequencing Primer
(F):5'- CAGCACCCTGGGATTAGAGAC -3'
(R):5'- GTCAGTCTCTGTGAGCTCCTATAAG -3'
Posted On2015-04-06